Incidental Mutation 'R1337:Engase'
ID156914
Institutional Source Beutler Lab
Gene Symbol Engase
Ensembl Gene ENSMUSG00000033857
Gene Nameendo-beta-N-acetylglucosaminidase
Synonyms
MMRRC Submission 039402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1337 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118476829-118489209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118482574 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 248 (T248A)
Ref Sequence ENSEMBL: ENSMUSP00000117538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043447] [ENSMUST00000135383] [ENSMUST00000139917] [ENSMUST00000166995] [ENSMUST00000168689] [ENSMUST00000171769] [ENSMUST00000172279]
Predicted Effect probably benign
Transcript: ENSMUST00000043447
Predicted Effect possibly damaging
Transcript: ENSMUST00000135383
AA Change: T248A

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117538
Gene: ENSMUSG00000033857
AA Change: T248A

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Glyco_hydro_85 127 404 2.6e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139813
Predicted Effect probably benign
Transcript: ENSMUST00000139917
SMART Domains Protein: ENSMUSP00000129698
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153825
Predicted Effect probably benign
Transcript: ENSMUST00000166995
SMART Domains Protein: ENSMUSP00000127862
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168689
SMART Domains Protein: ENSMUSP00000125886
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
PDB:3FHA|D 13 143 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168785
Predicted Effect probably benign
Transcript: ENSMUST00000171769
SMART Domains Protein: ENSMUSP00000132734
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172279
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme which catalyzes the hydrolysis of peptides and proteins with mannose modifications to produce free oligosaccharides. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozgyous for knock-out alleles of this gene and Ngly1 exhibit restored endoplasmic reticulum (ER)-associated degradation (ERAD) process compared with MEFs lacking only Ngly1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,769,033 S37P unknown Het
Abca12 T C 1: 71,294,819 I1175V probably benign Het
Ager G T 17: 34,600,622 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1c A G 6: 118,627,455 I1278T probably damaging Het
Casp8ap2 T C 4: 32,645,721 V1598A possibly damaging Het
Cdk12 T C 11: 98,245,671 probably null Het
Ces2g A T 8: 104,963,965 Y126F possibly damaging Het
Ehbp1l1 A T 19: 5,718,230 M1015K probably benign Het
Gsdma C T 11: 98,669,707 Q162* probably null Het
Hapln3 T C 7: 79,118,076 E190G probably benign Het
Hdc T C 2: 126,616,276 Q42R probably benign Het
Larp1b C T 3: 41,033,402 P20S probably damaging Het
Macf1 T G 4: 123,476,275 R1564S probably benign Het
Muc5b A G 7: 141,858,624 Y1769C unknown Het
Nup88 T A 11: 70,944,890 Q576L probably damaging Het
Olfr566 T C 7: 102,856,871 N137S probably benign Het
Olfr836 A G 9: 19,121,803 I280V probably benign Het
Prune2 C T 19: 17,119,607 S825L possibly damaging Het
Ryr3 C A 2: 112,779,963 M2301I possibly damaging Het
Sdk2 A C 11: 113,832,331 V1278G possibly damaging Het
Sertad3 T C 7: 27,476,441 L100P probably damaging Het
Slco5a1 T C 1: 12,939,142 T370A probably benign Het
Srrm1 A G 4: 135,346,733 probably null Het
Stk32a A G 18: 43,261,349 D121G probably benign Het
Ttc7 A T 17: 87,290,296 R99W probably damaging Het
Xkr9 C A 1: 13,701,124 S288Y possibly damaging Het
Zfp644 A G 5: 106,637,554 S376P probably damaging Het
Other mutations in Engase
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Engase APN 11 118482970 missense possibly damaging 0.91
IGL00963:Engase APN 11 118482998 missense probably damaging 1.00
IGL02652:Engase APN 11 118478950 missense probably damaging 0.99
R0135:Engase UTSW 11 118484478 missense possibly damaging 0.68
R1435:Engase UTSW 11 118484901 missense probably damaging 1.00
R1515:Engase UTSW 11 118487140 missense possibly damaging 0.53
R1889:Engase UTSW 11 118478933 missense probably damaging 1.00
R1939:Engase UTSW 11 118479186 missense probably damaging 1.00
R4628:Engase UTSW 11 118484905 missense probably damaging 1.00
R4730:Engase UTSW 11 118482922 missense probably damaging 1.00
R4762:Engase UTSW 11 118487094 missense possibly damaging 0.89
R4775:Engase UTSW 11 118482671 missense probably benign 0.22
R5155:Engase UTSW 11 118481281 missense probably benign 0.25
R5271:Engase UTSW 11 118481397 missense probably damaging 0.99
R5688:Engase UTSW 11 118487320 missense possibly damaging 0.91
R6659:Engase UTSW 11 118481316 missense probably benign 0.07
R7104:Engase UTSW 11 118481295 missense not run
Predicted Primers PCR Primer
(F):5'- AGGATGGCTAGGTCCTCCCTGATG -3'
(R):5'- TCCCTGATGCTCACAGGCACAC -3'

Sequencing Primer
(F):5'- GGCCATGAGACATGGGAC -3'
(R):5'- AATGGTCCCACCCGAGAG -3'
Posted On2014-02-11