Incidental Mutation 'R1412:Itga2b'
ID 159645
Institutional Source Beutler Lab
Gene Symbol Itga2b
Ensembl Gene ENSMUSG00000034664
Gene Name integrin alpha 2b
Synonyms CD41, GpIIb, platelet glycoprotein IIb, alphaIIb, GP IIb
MMRRC Submission 039468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R1412 (G1)
Quality Score 207
Status Validated
Chromosome 11
Chromosomal Location 102344123-102360709 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102347831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 890 (L890Q)
Ref Sequence ENSEMBL: ENSMUSP00000099375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103086]
AlphaFold Q9QUM0
Predicted Effect probably benign
Transcript: ENSMUST00000103086
AA Change: L890Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664
AA Change: L890Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151625
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,867,359 (GRCm39) probably benign Het
Abca15 C T 7: 119,944,546 (GRCm39) R394C possibly damaging Het
Adamts9 T C 6: 92,773,414 (GRCm39) Q1152R probably benign Het
Adgrv1 C T 13: 81,243,569 (GRCm39) G6277E probably damaging Het
Agbl2 A G 2: 90,619,298 (GRCm39) N41S probably benign Het
Akap7 A T 10: 25,165,495 (GRCm39) probably null Het
Arl6ip1 A G 7: 117,719,591 (GRCm39) I179T possibly damaging Het
Atp1a4 C T 1: 172,059,576 (GRCm39) D839N probably damaging Het
B3galt4 G A 17: 34,169,813 (GRCm39) R142C probably damaging Het
C1qtnf12 T C 4: 156,047,190 (GRCm39) V52A probably benign Het
C1qtnf2 A G 11: 43,381,959 (GRCm39) Y257C probably damaging Het
Cdc123 A T 2: 5,808,776 (GRCm39) D233E possibly damaging Het
Chdh G A 14: 29,756,680 (GRCm39) E369K probably benign Het
D630045J12Rik A G 6: 38,172,695 (GRCm39) V491A probably benign Het
Focad T C 4: 88,196,498 (GRCm39) probably null Het
Gabbr1 T C 17: 37,365,805 (GRCm39) probably null Het
Hat1 G T 2: 71,250,961 (GRCm39) E170* probably null Het
Hs3st5 A T 10: 36,708,672 (GRCm39) H69L probably benign Het
Igsf10 T C 3: 59,235,196 (GRCm39) probably benign Het
Or52e8b A G 7: 104,673,402 (GRCm39) F262L probably damaging Het
Or7d11 C G 9: 19,966,711 (GRCm39) G16A possibly damaging Het
Parp10 A G 15: 76,127,284 (GRCm39) L51P probably damaging Het
Pbld2 A G 10: 62,883,301 (GRCm39) T108A probably damaging Het
Pdlim2 A T 14: 70,411,773 (GRCm39) probably benign Het
Pikfyve T C 1: 65,241,989 (GRCm39) V243A possibly damaging Het
Pla2g12b G A 10: 59,239,804 (GRCm39) probably null Het
Raly A G 2: 154,699,315 (GRCm39) T40A possibly damaging Het
Rasgrp3 G T 17: 75,816,822 (GRCm39) probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Smim22 G C 16: 4,825,649 (GRCm39) E11D possibly damaging Het
Socs2 T C 10: 95,250,780 (GRCm39) S18G probably benign Het
Srgap2 T C 1: 131,228,151 (GRCm39) E720G possibly damaging Het
Tas2r135 A G 6: 42,382,768 (GRCm39) I102M probably benign Het
Tex19.2 A G 11: 121,007,761 (GRCm39) V229A possibly damaging Het
Vmn1r234 T A 17: 21,449,512 (GRCm39) I142N probably benign Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Vwa3a C T 7: 120,379,377 (GRCm39) T494I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Zfhx3 A G 8: 109,641,199 (GRCm39) D1166G possibly damaging Het
Other mutations in Itga2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Itga2b APN 11 102,346,409 (GRCm39) missense probably damaging 1.00
IGL02197:Itga2b APN 11 102,357,145 (GRCm39) missense probably benign 0.19
IGL02349:Itga2b APN 11 102,352,189 (GRCm39) missense probably damaging 0.98
IGL02711:Itga2b APN 11 102,356,551 (GRCm39) missense possibly damaging 0.53
R0282:Itga2b UTSW 11 102,351,672 (GRCm39) missense probably damaging 0.99
R0349:Itga2b UTSW 11 102,358,252 (GRCm39) missense probably damaging 0.98
R0384:Itga2b UTSW 11 102,356,188 (GRCm39) splice site probably null
R0403:Itga2b UTSW 11 102,358,152 (GRCm39) critical splice donor site probably null
R0452:Itga2b UTSW 11 102,356,779 (GRCm39) splice site probably null
R0535:Itga2b UTSW 11 102,348,359 (GRCm39) missense possibly damaging 0.65
R1517:Itga2b UTSW 11 102,357,151 (GRCm39) nonsense probably null
R1615:Itga2b UTSW 11 102,350,963 (GRCm39) critical splice donor site probably null
R1716:Itga2b UTSW 11 102,351,603 (GRCm39) missense probably benign 0.30
R1953:Itga2b UTSW 11 102,349,009 (GRCm39) missense probably benign 0.18
R2001:Itga2b UTSW 11 102,358,165 (GRCm39) missense probably benign
R2216:Itga2b UTSW 11 102,358,692 (GRCm39) missense probably benign 0.35
R4193:Itga2b UTSW 11 102,360,511 (GRCm39) missense probably benign 0.01
R4770:Itga2b UTSW 11 102,351,582 (GRCm39) missense probably damaging 1.00
R4805:Itga2b UTSW 11 102,358,692 (GRCm39) missense probably benign 0.00
R4880:Itga2b UTSW 11 102,348,548 (GRCm39) intron probably benign
R4906:Itga2b UTSW 11 102,351,985 (GRCm39) missense probably benign 0.43
R5112:Itga2b UTSW 11 102,349,017 (GRCm39) missense probably damaging 0.99
R5362:Itga2b UTSW 11 102,351,961 (GRCm39) missense probably damaging 0.99
R5739:Itga2b UTSW 11 102,356,735 (GRCm39) missense probably benign 0.14
R5761:Itga2b UTSW 11 102,357,100 (GRCm39) missense probably benign 0.00
R5840:Itga2b UTSW 11 102,352,157 (GRCm39) missense probably damaging 1.00
R5851:Itga2b UTSW 11 102,348,427 (GRCm39) intron probably benign
R6239:Itga2b UTSW 11 102,356,144 (GRCm39) missense possibly damaging 0.61
R6491:Itga2b UTSW 11 102,350,695 (GRCm39) splice site probably null
R7426:Itga2b UTSW 11 102,347,120 (GRCm39) missense probably benign 0.01
R7635:Itga2b UTSW 11 102,352,582 (GRCm39) missense probably damaging 1.00
R7664:Itga2b UTSW 11 102,351,666 (GRCm39) missense probably damaging 1.00
R7832:Itga2b UTSW 11 102,348,108 (GRCm39) missense probably damaging 0.98
R8120:Itga2b UTSW 11 102,360,368 (GRCm39) missense probably damaging 0.98
R8254:Itga2b UTSW 11 102,358,212 (GRCm39) missense probably benign 0.16
R8296:Itga2b UTSW 11 102,351,985 (GRCm39) missense possibly damaging 0.79
R8362:Itga2b UTSW 11 102,352,189 (GRCm39) missense probably damaging 1.00
R8815:Itga2b UTSW 11 102,351,687 (GRCm39) missense possibly damaging 0.91
R8901:Itga2b UTSW 11 102,351,630 (GRCm39) missense probably damaging 0.99
R8985:Itga2b UTSW 11 102,356,288 (GRCm39) intron probably benign
R9277:Itga2b UTSW 11 102,351,982 (GRCm39) missense probably damaging 1.00
R9335:Itga2b UTSW 11 102,346,478 (GRCm39) missense probably damaging 0.99
R9496:Itga2b UTSW 11 102,358,629 (GRCm39) missense probably damaging 1.00
R9779:Itga2b UTSW 11 102,348,147 (GRCm39) missense probably damaging 1.00
Z1177:Itga2b UTSW 11 102,357,902 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCCAACAGTCCAGGGATACAG -3'
(R):5'- ACAGCCATCTCCCAAGGTAAGGTTC -3'

Sequencing Primer
(F):5'- agacagagagagacagagagac -3'
(R):5'- CCCAAGGTAAGGTTCTGGGAG -3'
Posted On 2014-03-14