Incidental Mutation 'R1475:Cdk11b'
ID163992
Institutional Source Beutler Lab
Gene Symbol Cdk11b
Ensembl Gene ENSMUSG00000029062
Gene Namecyclin-dependent kinase 11B
SynonymsPITSLRE proteins, CDK11-p110, Cdc2l1, Cdc2l2, CDK11-p46, CDK11-p58
MMRRC Submission 039528-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1475 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155624854-155649938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155634217 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 208 (R208H)
Ref Sequence ENSEMBL: ENSMUSP00000101225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067081] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000115821]
Predicted Effect probably damaging
Transcript: ENSMUST00000067081
AA Change: R208H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062
AA Change: R208H

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105598
AA Change: R174H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062
AA Change: R174H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105600
AA Change: R208H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062
AA Change: R208H

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142513
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null embryos display embryonic lethality from cell cycle arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A T 8: 121,540,588 probably benign Het
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dffa T A 4: 149,117,478 L171Q probably damaging Het
Emcn C T 3: 137,379,907 H89Y possibly damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Il23r C A 6: 67,452,296 probably null Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Nmnat2 G A 1: 153,074,695 R42H probably damaging Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Olfr901 T A 9: 38,430,864 V194D probably benign Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Plekhm2 T C 4: 141,627,854 D954G possibly damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Usp50 T C 2: 126,769,867 probably null Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in Cdk11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Cdk11b APN 4 155628803 missense possibly damaging 0.54
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0145:Cdk11b UTSW 4 155641619 intron probably benign
R0372:Cdk11b UTSW 4 155641500 intron probably benign
R0426:Cdk11b UTSW 4 155642512 intron probably benign
R0471:Cdk11b UTSW 4 155647542 unclassified probably benign
R0627:Cdk11b UTSW 4 155640772 intron probably benign
R1611:Cdk11b UTSW 4 155641575 intron probably benign
R1719:Cdk11b UTSW 4 155648397 unclassified probably benign
R1750:Cdk11b UTSW 4 155628680 intron probably null
R2061:Cdk11b UTSW 4 155641604 intron probably benign
R2274:Cdk11b UTSW 4 155647594 unclassified probably benign
R2922:Cdk11b UTSW 4 155640744 intron probably benign
R3719:Cdk11b UTSW 4 155626886 missense probably damaging 1.00
R3917:Cdk11b UTSW 4 155626801 missense probably damaging 1.00
R4077:Cdk11b UTSW 4 155639747 intron probably benign
R4078:Cdk11b UTSW 4 155639747 intron probably benign
R5033:Cdk11b UTSW 4 155648825 unclassified probably benign
R5212:Cdk11b UTSW 4 155638615 intron probably null
R5556:Cdk11b UTSW 4 155634147 nonsense probably null
R5622:Cdk11b UTSW 4 155630217 missense probably damaging 1.00
R5927:Cdk11b UTSW 4 155648240 unclassified probably benign
R5975:Cdk11b UTSW 4 155648240 unclassified probably benign
R6276:Cdk11b UTSW 4 155634190 missense probably benign 0.11
R6278:Cdk11b UTSW 4 155649603 unclassified probably benign
R6905:Cdk11b UTSW 4 155641608 intron probably benign
R6998:Cdk11b UTSW 4 155648343 nonsense probably null
R7021:Cdk11b UTSW 4 155641567 intron probably benign
R7062:Cdk11b UTSW 4 155626811 missense probably damaging 1.00
R7100:Cdk11b UTSW 4 155625593 missense probably damaging 1.00
Z1088:Cdk11b UTSW 4 155641564 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGTCTAAGAGACTTCTGTCAGCC -3'
(R):5'- AAGAACTACCCGCCTGTTTCTGCC -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- GTTTCTGCCTCCCGTCAG -3'
Posted On2014-03-28