Incidental Mutation 'R1561:Slc2a1'
ID170591
Institutional Source Beutler Lab
Gene Symbol Slc2a1
Ensembl Gene ENSMUSG00000028645
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 1
SynonymsGlut1, Glut-1
MMRRC Submission 039600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1561 (G1)
Quality Score132
Status Not validated
Chromosome4
Chromosomal Location119108711-119137983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119136409 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 481 (E481G)
Ref Sequence ENSEMBL: ENSMUSP00000030398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030398] [ENSMUST00000134105] [ENSMUST00000144329] [ENSMUST00000174372] [ENSMUST00000208090]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030398
AA Change: E481G

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030398
Gene: ENSMUSG00000028645
AA Change: E481G

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 467 1e-164 PFAM
Pfam:MFS_1 24 418 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134105
SMART Domains Protein: ENSMUSP00000118641
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 12 128 7.7e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143801
Predicted Effect probably benign
Transcript: ENSMUST00000144329
SMART Domains Protein: ENSMUSP00000134126
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 4 123 1.5e-35 PFAM
Pfam:MFS_1 5 123 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174372
SMART Domains Protein: ENSMUSP00000134714
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 173 9.3e-53 PFAM
Pfam:MFS_1 18 172 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208090
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major glucose transporter in the mammalian blood-brain barrier. The encoded protein is found primarily in the cell membrane and on the cell surface, where it can also function as a receptor for human T-cell leukemia virus (HTLV) I and II. Mutations in this gene have been found in a family with paroxysmal exertion-induced dyskinesia. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null embryos are small, lack visibly detectable eyes, show a diminutive rostral embryonic pole and an overall developmental delay, and die at E10-E14. Heterozygotes show spontaneous seizures, impaired motor performance, hypoglycorrhachia, microencephaly, and reduced brain glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,431 N69D probably benign Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Ap1g2 T C 14: 55,104,887 E171G probably damaging Het
Atg7 T C 6: 114,701,172 V341A possibly damaging Het
Bace1 G T 9: 45,839,194 R56L probably benign Het
Chfr A T 5: 110,158,808 D472V probably benign Het
Ckap2l G A 2: 129,270,725 T621I probably benign Het
Cmip A G 8: 117,453,850 T554A probably benign Het
Crocc C T 4: 141,030,268 E905K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
F5 C A 1: 164,186,903 S581* probably null Het
Fam227a T A 15: 79,636,762 Y291F possibly damaging Het
Gm609 A G 16: 45,442,512 V88A possibly damaging Het
Gpr151 A T 18: 42,579,156 S152R probably benign Het
Gpr158 A T 2: 21,815,694 probably null Het
Kcna5 T C 6: 126,534,583 Y194C probably damaging Het
Khsrp A G 17: 57,025,639 S214P probably benign Het
Mrgprb1 C G 7: 48,447,125 probably null Het
Mrnip C T 11: 50,176,849 T30I probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Naca G T 10: 128,040,398 probably benign Het
Obscn T G 11: 59,036,073 T5539P probably damaging Het
Olfr1154 C T 2: 87,903,161 V172I probably benign Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Ovca2 A G 11: 75,177,979 L198P probably damaging Het
Pdzrn4 T C 15: 92,677,637 V308A possibly damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Polr3b T A 10: 84,634,912 M139K probably damaging Het
Prkag2 T C 5: 24,871,595 Y191C probably damaging Het
Prss47 A T 13: 65,046,248 C278S probably damaging Het
Ptprm T C 17: 66,940,541 T600A probably damaging Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sf3a1 T C 11: 4,179,217 V726A probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc26a3 A G 12: 31,466,452 N603S probably benign Het
Slc35a5 A C 16: 45,151,521 S127A possibly damaging Het
Spen C A 4: 141,472,383 G2978* probably null Het
Srrt T A 5: 137,300,019 E297V probably benign Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmem65 T A 15: 58,822,858 I91F probably benign Het
Top2b A G 14: 16,398,993 K538E possibly damaging Het
Trappc8 G A 18: 20,841,623 R883* probably null Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Vav3 T C 3: 109,494,838 probably null Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Zan A T 5: 137,380,838 Y5333* probably null Het
Zfp994 A C 17: 22,201,225 F248V probably damaging Het
Other mutations in Slc2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Slc2a1 APN 4 119132238 missense possibly damaging 0.94
IGL01876:Slc2a1 APN 4 119133378 missense probably benign 0.11
IGL02355:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
IGL02362:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
R1076:Slc2a1 UTSW 4 119134448 missense probably damaging 0.98
R1616:Slc2a1 UTSW 4 119136306 missense probably damaging 1.00
R3015:Slc2a1 UTSW 4 119132143 missense probably damaging 1.00
R4166:Slc2a1 UTSW 4 119133116 missense probably damaging 0.97
R4795:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R4796:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R6025:Slc2a1 UTSW 4 119136342 missense possibly damaging 0.68
R7403:Slc2a1 UTSW 4 119132555 missense probably damaging 1.00
R7429:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7430:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7524:Slc2a1 UTSW 4 119132612 missense not run
Predicted Primers PCR Primer
(F):5'- ACCAAAGGTTCAGAGGTTCGTGTTG -3'
(R):5'- ACTTCACTGCTGGCTGAGGAAAGG -3'

Sequencing Primer
(F):5'- AGAGCATGGCAGGACCC -3'
(R):5'- AAGAGGTCTCATCTAGCTGCCT -3'
Posted On2014-04-13