Incidental Mutation 'R1634:Map3k20'
ID172955
Institutional Source Beutler Lab
Gene Symbol Map3k20
Ensembl Gene ENSMUSG00000004085
Gene Namemitogen-activated protein kinase kinase kinase 20
SynonymsMLTKalpha, Zak, MLTKbeta, B230120H23Rik
MMRRC Submission 039671-MU
Accession Numbers

Genbank: NM_023057, NM_178084; MGI: 2443258

Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R1634 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location72285637-72442610 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 72410177 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 339 (W339*)
Ref Sequence ENSEMBL: ENSMUSP00000088334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090824] [ENSMUST00000135469]
Predicted Effect probably null
Transcript: ENSMUST00000090824
AA Change: W339*
SMART Domains Protein: ENSMUSP00000088334
Gene: ENSMUSG00000004085
AA Change: W339*

DomainStartEndE-ValueType
Pfam:Pkinase 16 259 6.3e-56 PFAM
Pfam:Pkinase_Tyr 16 260 9.9e-64 PFAM
coiled coil region 277 328 N/A INTRINSIC
SAM 336 410 5.59e-7 SMART
low complexity region 643 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135469
SMART Domains Protein: ENSMUSP00000118983
Gene: ENSMUSG00000004085

DomainStartEndE-ValueType
Pfam:Pkinase 16 259 1.1e-59 PFAM
Pfam:Pkinase_Tyr 16 260 7.6e-65 PFAM
coiled coil region 277 328 N/A INTRINSIC
low complexity region 428 452 N/A INTRINSIC
Meta Mutation Damage Score 0.574 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MAPKKK family of signal transduction molecules and encodes a protein with an N-terminal kinase catalytic domain, followed by a leucine zipper motif and a sterile-alpha motif (SAM). This magnesium-binding protein forms homodimers and is located in the cytoplasm. The protein mediates gamma radiation signaling leading to cell cycle arrest and activity of this protein plays a role in cell cycle checkpoint regulation in cells. The protein also has pro-apoptotic activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality at E9.5 with growth retardation. Mice homozygous for an allele lacking the SAM domain exhibit low penetrant unilateral complex hindlimb duplication phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,057,731 F222I probably damaging Het
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dgki A G 6: 36,915,490 M851T probably benign Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Dzank1 G A 2: 144,481,669 A618V probably benign Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Hoxb4 C A 11: 96,320,273 probably benign Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Olfr161 A G 16: 3,593,209 D271G probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rgl1 C T 1: 152,524,772 R624H probably damaging Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Scn9a A G 2: 66,488,017 S1477P probably damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Spns1 C T 7: 126,371,171 probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Map3k20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Map3k20 APN 2 72412170 missense probably damaging 1.00
IGL00333:Map3k20 APN 2 72371976 missense probably damaging 0.99
IGL00505:Map3k20 APN 2 72389483 missense probably damaging 1.00
IGL01472:Map3k20 APN 2 72355553 splice site probably benign
IGL01982:Map3k20 APN 2 72298333 nonsense probably null
IGL02556:Map3k20 APN 2 72371895 missense probably damaging 0.98
IGL02831:Map3k20 APN 2 72371727 missense probably damaging 1.00
3-1:Map3k20 UTSW 2 72412125 missense probably damaging 1.00
R0765:Map3k20 UTSW 2 72371925 missense probably damaging 1.00
R1160:Map3k20 UTSW 2 72441520 missense probably benign 0.01
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1509:Map3k20 UTSW 2 72364624 splice site probably benign
R1723:Map3k20 UTSW 2 72389492 missense probably damaging 1.00
R1986:Map3k20 UTSW 2 72441294 nonsense probably null
R2014:Map3k20 UTSW 2 72438260 missense probably benign 0.00
R2086:Map3k20 UTSW 2 72398385 missense probably benign 0.01
R2311:Map3k20 UTSW 2 72368440 missense probably damaging 1.00
R2655:Map3k20 UTSW 2 72433420 missense probably damaging 1.00
R3150:Map3k20 UTSW 2 72371992 missense probably damaging 1.00
R3781:Map3k20 UTSW 2 72402355 intron probably benign
R3950:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3951:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3952:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3981:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3982:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3983:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R4011:Map3k20 UTSW 2 72384124 splice site probably benign
R4180:Map3k20 UTSW 2 72441571 missense probably damaging 0.97
R4790:Map3k20 UTSW 2 72441704 missense probably benign
R4895:Map3k20 UTSW 2 72402356 intron probably benign
R4943:Map3k20 UTSW 2 72371918 missense possibly damaging 0.90
R4983:Map3k20 UTSW 2 72402067 missense probably benign 0.00
R5023:Map3k20 UTSW 2 72402345 intron probably benign
R5157:Map3k20 UTSW 2 72438214 missense probably benign 0.00
R5703:Map3k20 UTSW 2 72402170 missense probably benign 0.00
R6134:Map3k20 UTSW 2 72410159 missense probably damaging 0.99
R6322:Map3k20 UTSW 2 72433470 missense possibly damaging 0.95
R6418:Map3k20 UTSW 2 72402113 missense probably benign 0.15
R6449:Map3k20 UTSW 2 72398414 missense probably damaging 1.00
R6495:Map3k20 UTSW 2 72368419 missense probably damaging 1.00
R6508:Map3k20 UTSW 2 72441909 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CACAAGGTGAAATGGGTTGTTGCTG -3'
(R):5'- AGCCCTCTCCTAAGGCTTGAAGAC -3'

Sequencing Primer
(F):5'- CGTGGACTGGCTCTGAGAAG -3'
(R):5'- CTCCTAAGGCTTGAAGACCTAGTTG -3'
Posted On2014-04-24