Incidental Mutation 'R1634:Dzank1'
ID172963
Institutional Source Beutler Lab
Gene Symbol Dzank1
Ensembl Gene ENSMUSG00000037259
Gene Namedouble zinc ribbon and ankyrin repeat domains 1
Synonyms2810039F03Rik, 6330439K17Rik, Ankrd64
MMRRC Submission 039671-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1634 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location144470557-144527414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144481669 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 618 (A618V)
Ref Sequence ENSEMBL: ENSMUSP00000080643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081982] [ENSMUST00000163701]
Predicted Effect probably benign
Transcript: ENSMUST00000081982
AA Change: A618V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259
AA Change: A618V

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 11 99 1.1e-16 PFAM
Pfam:CHB_HEX_C_1 20 97 4.5e-18 PFAM
Pfam:Fn3_assoc 32 100 1.6e-17 PFAM
ZnF_RBZ 268 292 5.44e0 SMART
ZnF_RBZ 307 331 2.55e0 SMART
Blast:ZnF_RBZ 355 378 1e-7 BLAST
ZnF_RBZ 385 409 3.13e0 SMART
low complexity region 591 604 N/A INTRINSIC
ANK 631 662 2.97e2 SMART
ANK 666 695 2.83e0 SMART
Blast:ANK 700 731 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149523
Predicted Effect probably benign
Transcript: ENSMUST00000163701
AA Change: A619V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133177
Gene: ENSMUSG00000037259
AA Change: A619V

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 12 99 1.5e-17 PFAM
Pfam:CHB_HEX_C_1 21 97 8.5e-17 PFAM
Pfam:Fn3_assoc 32 100 3.7e-18 PFAM
ZnF_RBZ 269 293 5.44e0 SMART
ZnF_RBZ 308 332 2.55e0 SMART
Blast:ZnF_RBZ 356 379 1e-7 BLAST
ZnF_RBZ 386 410 3.13e0 SMART
low complexity region 592 605 N/A INTRINSIC
ANK 632 663 2.97e2 SMART
ANK 667 696 2.83e0 SMART
Blast:ANK 701 732 7e-12 BLAST
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.4%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,057,731 F222I probably damaging Het
Adam34 A T 8: 43,652,090 C173S possibly damaging Het
Ahi1 T C 10: 20,965,693 V293A probably damaging Het
AI182371 A T 2: 35,086,485 Y223N probably damaging Het
Armc4 A G 18: 7,286,688 L181P probably damaging Het
Asmt C A X: 170,675,829 F181L probably damaging Het
Axin1 T A 17: 26,187,991 H519Q probably damaging Het
Cdc5l A T 17: 45,404,706 V660E probably damaging Het
Cep152 C T 2: 125,583,889 R852H probably benign Het
Cpne4 T C 9: 104,989,579 V230A possibly damaging Het
Cttnbp2 A T 6: 18,408,657 N988K probably benign Het
D430041D05Rik A G 2: 104,221,211 I767T probably damaging Het
Dgki A G 6: 36,915,490 M851T probably benign Het
Dnah8 T C 17: 30,713,098 probably null Het
Dscaml1 A G 9: 45,672,749 E504G probably damaging Het
Fam189b A C 3: 89,188,094 Y511S probably damaging Het
Fat2 T A 11: 55,267,684 S3403C probably damaging Het
Fat2 C T 11: 55,284,719 V1723I probably benign Het
Flt1 A T 5: 147,676,430 F334I probably damaging Het
Galnt12 G T 4: 47,108,585 probably null Het
Gzmc T C 14: 56,232,280 I188V possibly damaging Het
Herc1 T C 9: 66,473,538 S3566P possibly damaging Het
Hoxb4 C A 11: 96,320,273 probably benign Het
Idh3b C T 2: 130,281,745 V141I probably benign Het
Kif24 A G 4: 41,393,529 S1249P probably benign Het
Leo1 T C 9: 75,466,260 Y656H possibly damaging Het
Map3k20 G A 2: 72,410,177 W339* probably null Het
Map3k5 T C 10: 20,136,911 V1259A possibly damaging Het
Masp2 A G 4: 148,614,355 D631G probably damaging Het
Mink1 T C 11: 70,608,880 S713P probably benign Het
Mpp7 A T 18: 7,350,984 V571E possibly damaging Het
Nell1 A G 7: 50,848,558 D574G possibly damaging Het
Obscn T C 11: 59,076,896 Y392C probably damaging Het
Olfml2a A T 2: 38,960,219 Y649F probably benign Het
Olfr1295 T C 2: 111,565,346 M33V probably benign Het
Olfr161 A G 16: 3,593,209 D271G probably benign Het
Prkcg A G 7: 3,323,470 D484G probably damaging Het
Rab27a T C 9: 73,075,569 probably null Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rgl1 C T 1: 152,524,772 R624H probably damaging Het
Ric8b G A 10: 84,970,748 G159D probably damaging Het
Sbno2 C A 10: 80,060,634 A880S possibly damaging Het
Scn9a A G 2: 66,488,017 S1477P probably damaging Het
Sec22a T C 16: 35,318,873 probably benign Het
Snx14 T C 9: 88,385,739 I714M probably benign Het
Snx14 T C 9: 88,407,490 probably benign Het
Sphk2 T A 7: 45,711,540 T347S probably benign Het
Spns1 C T 7: 126,371,171 probably benign Het
Susd2 A G 10: 75,637,555 V675A probably benign Het
Sytl2 A T 7: 90,395,182 D566V probably damaging Het
Tcf25 T A 8: 123,397,091 I464N possibly damaging Het
Tex261 A T 6: 83,775,022 I49N possibly damaging Het
Tjp1 A G 7: 65,302,952 F1545L possibly damaging Het
Tmem176b A G 6: 48,834,566 S216P probably damaging Het
Topaz1 C T 9: 122,780,675 probably benign Het
Tra2a C T 6: 49,250,957 probably benign Het
Ttn A G 2: 76,722,782 F22794S possibly damaging Het
Uox G A 3: 146,612,383 W93* probably null Het
Zan A T 5: 137,412,790 probably benign Het
Zfp106 G A 2: 120,533,677 R750* probably null Het
Zfp638 A T 6: 83,979,912 probably null Het
Other mutations in Dzank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dzank1 APN 2 144481725 nonsense probably null
IGL00955:Dzank1 APN 2 144490174 missense probably benign 0.22
IGL01888:Dzank1 APN 2 144476154 splice site probably null
IGL02108:Dzank1 APN 2 144506223 missense probably benign 0.02
IGL02979:Dzank1 APN 2 144488738 missense probably damaging 1.00
PIT4466001:Dzank1 UTSW 2 144483373 missense probably benign 0.00
R0388:Dzank1 UTSW 2 144476106 missense possibly damaging 0.86
R0603:Dzank1 UTSW 2 144511512 missense probably benign 0.04
R1052:Dzank1 UTSW 2 144513445 missense probably benign
R1386:Dzank1 UTSW 2 144491831 missense probably benign 0.05
R1529:Dzank1 UTSW 2 144482188 missense probably benign 0.01
R2761:Dzank1 UTSW 2 144513449 missense probably benign
R4024:Dzank1 UTSW 2 144482227 missense probably benign
R4279:Dzank1 UTSW 2 144491845 missense probably benign 0.00
R4324:Dzank1 UTSW 2 144488698 missense possibly damaging 0.95
R4516:Dzank1 UTSW 2 144510122 intron probably benign
R4713:Dzank1 UTSW 2 144491804 missense probably benign 0.13
R4782:Dzank1 UTSW 2 144504399 missense probably damaging 1.00
R4994:Dzank1 UTSW 2 144522566 missense probably damaging 1.00
R5157:Dzank1 UTSW 2 144483412 missense probably damaging 0.98
R5514:Dzank1 UTSW 2 144481685 missense probably benign 0.01
R5580:Dzank1 UTSW 2 144506178 missense probably damaging 1.00
R5635:Dzank1 UTSW 2 144483407 missense probably damaging 1.00
R5793:Dzank1 UTSW 2 144506224 missense probably benign 0.14
R5820:Dzank1 UTSW 2 144513488 missense probably damaging 1.00
R5976:Dzank1 UTSW 2 144501489 missense probably damaging 1.00
R6935:Dzank1 UTSW 2 144476094 missense possibly damaging 0.64
R6980:Dzank1 UTSW 2 144490136 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTTACACTGGACAGCCCAGGTCTC -3'
(R):5'- AGGCAGCGTATTTCTCTGGCTTC -3'

Sequencing Primer
(F):5'- GGGTCGTCATGTATTTAGCCAAAC -3'
(R):5'- AGTTTATTTGCTTTACCCAGAGAGG -3'
Posted On2014-04-24