Incidental Mutation 'R1568:Bdnf'
ID175395
Institutional Source Beutler Lab
Gene Symbol Bdnf
Ensembl Gene ENSMUSG00000048482
Gene Namebrain derived neurotrophic factor
Synonyms
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R1568 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location109674700-109727007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109723794 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 131 (H131R)
Ref Sequence ENSEMBL: ENSMUSP00000135762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053317] [ENSMUST00000111042] [ENSMUST00000111043] [ENSMUST00000111044] [ENSMUST00000111045] [ENSMUST00000111046] [ENSMUST00000111047] [ENSMUST00000111049] [ENSMUST00000111050] [ENSMUST00000111051] [ENSMUST00000176893]
Predicted Effect probably damaging
Transcript: ENSMUST00000053317
AA Change: H139R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057989
Gene: ENSMUSG00000048482
AA Change: H139R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
NGF 143 250 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111042
AA Change: H171R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106671
Gene: ENSMUSG00000048482
AA Change: H171R

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
NGF 175 282 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111043
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106672
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111044
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106673
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111045
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106674
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111046
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106675
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111047
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106676
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111049
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106678
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111050
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106679
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111051
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106680
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176893
AA Change: H131R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135762
Gene: ENSMUSG00000048482
AA Change: H131R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the nerve growth factor family. It is involved in the growth, differentiation and survival of specific types of developing neurons both in the central nervous system (CNS) and the peripheral nervous system. It is also involved in regulating synaptic plasticity in the CNS. Expression of a similar gene in human is reduced in both Alzheimer's and Huntington disease patients. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null alleles exhibit sensory neuron losses affecting coordination, balance, hearing, taste, and breathing, cerebellar abnormalities, increased sympathetic neuron number, and postnatal lethality. Carriers show mild defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Bdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Bdnf APN 2 109723547 missense probably benign 0.02
IGL01285:Bdnf APN 2 109723586 missense probably benign 0.02
IGL01595:Bdnf APN 2 109723928 nonsense probably null
IGL01737:Bdnf APN 2 109723755 missense probably damaging 1.00
IGL02450:Bdnf APN 2 109723604 missense possibly damaging 0.75
IGL02793:Bdnf APN 2 109723851 missense probably damaging 1.00
IGL02875:Bdnf APN 2 109723851 missense probably damaging 1.00
R0505:Bdnf UTSW 2 109675343 splice site probably null
R0626:Bdnf UTSW 2 109723538 missense probably benign 0.01
R0792:Bdnf UTSW 2 109724118 missense probably damaging 1.00
R2066:Bdnf UTSW 2 109723902 missense probably damaging 1.00
R4704:Bdnf UTSW 2 109723692 missense possibly damaging 0.89
R5000:Bdnf UTSW 2 109723648 missense probably benign 0.01
R5259:Bdnf UTSW 2 109723982 missense probably benign 0.37
R5301:Bdnf UTSW 2 109723539 missense probably benign
R6344:Bdnf UTSW 2 109723677 missense probably benign 0.01
R7392:Bdnf UTSW 2 109723930 missense probably benign 0.01
X0028:Bdnf UTSW 2 109723883 missense possibly damaging 0.77
X0058:Bdnf UTSW 2 109723637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGACACTTTTGAGCACGTCATC -3'
(R):5'- CATTGCGAGTTCCAGTGCCTTTTG -3'

Sequencing Primer
(F):5'- TTTTGAGCACGTCATCGAAGAG -3'
(R):5'- GCAGCCTTCCTTGGTGTAAC -3'
Posted On2014-04-24