Incidental Mutation 'R1568:Olfr658'
ID175421
Institutional Source Beutler Lab
Gene Symbol Olfr658
Ensembl Gene ENSMUSG00000070421
Gene Nameolfactory receptor 658
SynonymsGA_x6K02T2PBJ9-7273558-7272587, MOR34-5
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1568 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104642877-104647305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104644770 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 199 (I199F)
Ref Sequence ENSEMBL: ENSMUSP00000147498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089296] [ENSMUST00000210641]
Predicted Effect probably benign
Transcript: ENSMUST00000089296
AA Change: I201F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086711
Gene: ENSMUSG00000070421
AA Change: I201F

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1.9e-108 PFAM
Pfam:7TM_GPCR_Srsx 39 256 3.1e-9 PFAM
Pfam:7tm_1 45 297 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210641
AA Change: I199F

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Olfr658
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Olfr658 APN 7 104644480 nonsense probably null
IGL01408:Olfr658 APN 7 104644929 missense possibly damaging 0.61
IGL02612:Olfr658 APN 7 104644663 missense probably benign 0.00
R0241:Olfr658 UTSW 7 104645243 missense probably benign 0.00
R0241:Olfr658 UTSW 7 104645243 missense probably benign 0.00
R1171:Olfr658 UTSW 7 104644997 missense probably damaging 1.00
R1465:Olfr658 UTSW 7 104644946 missense probably benign 0.13
R1465:Olfr658 UTSW 7 104644946 missense probably benign 0.13
R1866:Olfr658 UTSW 7 104644797 missense probably benign 0.35
R4061:Olfr658 UTSW 7 104644473 nonsense probably null
R4233:Olfr658 UTSW 7 104644988 missense probably benign 0.15
R6080:Olfr658 UTSW 7 104645310 missense probably benign 0.01
R6479:Olfr658 UTSW 7 104645126 missense probably benign 0.02
R7222:Olfr658 UTSW 7 104644730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGATGGAGGTATTGTGTGCCC -3'
(R):5'- CCCAAAACCCTGTGCATCTTCTGG -3'

Sequencing Primer
(F):5'- GTATTGTGTGCCCCCCAAAG -3'
(R):5'- ATCCATACCTTCACGGGGATG -3'
Posted On2014-04-24