Incidental Mutation 'R1597:Mx1'
ID175902
Institutional Source Beutler Lab
Gene Symbol Mx1
Ensembl Gene ENSMUSG00000000386
Gene NameMX dynamin-like GTPase 1
SynonymsMx-1, Mx, myxovirus (influenza) resistance 1 polypeptide
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1597 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97447035-97462907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97455129 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 197 (M197L)
Ref Sequence ENSEMBL: ENSMUSP00000138532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023655] [ENSMUST00000113768] [ENSMUST00000135184] [ENSMUST00000142883] [ENSMUST00000155233] [ENSMUST00000232193] [ENSMUST00000232282]
Predicted Effect probably benign
Transcript: ENSMUST00000023655
AA Change: M197L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023655
Gene: ENSMUSG00000000386
AA Change: M197L

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
low complexity region 309 325 N/A INTRINSIC
Pfam:Dynamin_M 428 509 8.1e-12 PFAM
GED 534 625 5.58e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113768
AA Change: M197L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109397
Gene: ENSMUSG00000000386
AA Change: M197L

DomainStartEndE-ValueType
DYNc 12 241 1.34e-98 SMART
low complexity region 279 289 N/A INTRINSIC
GED 304 395 5.58e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135184
AA Change: M53L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138813
Gene: ENSMUSG00000000386
AA Change: M53L

DomainStartEndE-ValueType
DYNc 2 111 2.62e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142883
SMART Domains Protein: ENSMUSP00000114709
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
Pfam:Dynamin_N 39 65 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155233
AA Change: M197L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138532
Gene: ENSMUSG00000000386
AA Change: M197L

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231995
Predicted Effect probably benign
Transcript: ENSMUST00000232193
Predicted Effect probably damaging
Transcript: ENSMUST00000232282
AA Change: M197L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a member of the Mx protein family of large GTPases, and functions in the innate immunity system. Interferon alpha/beta treatment or viral infection induces expression of this protein, which subsequently accumulates in the cytoplasm and inhibits viral replication. It has been shown to confer resistance to the influenza virus. This gene produces a functional protein in some feral mouse strains, whereas some inbred mouse strains including the strain of the reference genome, C57BL/6J, contain a deletion or a nonsense mutation that results in a non-functional gene product. [provided by RefSeq, Aug 2015]
PHENOTYPE: A2G, SL/NiA, T9 and CAST/Ei strains produce the MX1 protein (Mx1+ allele) conferring resistance to myxoviruses, whereas no protein is made by the Mx1- susceptible alleles of C57BL/6J and many other inbred strains with an exon 9-11 deletion; or CBA/J, CE/J, I/LnJ and PERA/Ei with a nonsense mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Mx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Mx1 APN 16 97457432 missense probably damaging 1.00
IGL01328:Mx1 APN 16 97455632 missense probably damaging 0.99
IGL03105:Mx1 APN 16 97456354 missense possibly damaging 0.94
R0003:Mx1 UTSW 16 97451588 intron probably benign
R1753:Mx1 UTSW 16 97454158 missense probably damaging 1.00
R1780:Mx1 UTSW 16 97451512 makesense probably null
R1826:Mx1 UTSW 16 97455637 missense possibly damaging 0.95
R1851:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R1852:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R2059:Mx1 UTSW 16 97454179 nonsense probably null
R2223:Mx1 UTSW 16 97455232 splice site probably benign
R3441:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3442:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3782:Mx1 UTSW 16 97451995 missense possibly damaging 0.75
R4460:Mx1 UTSW 16 97454081 missense probably damaging 0.99
R4659:Mx1 UTSW 16 97455239 splice site probably null
R5116:Mx1 UTSW 16 97457479 missense possibly damaging 0.67
R5186:Mx1 UTSW 16 97455494 missense probably benign 0.09
R5215:Mx1 UTSW 16 97448360 missense possibly damaging 0.72
R5249:Mx1 UTSW 16 97457428 missense probably damaging 1.00
R5450:Mx1 UTSW 16 97454147 nonsense probably null
R5806:Mx1 UTSW 16 97454151 missense possibly damaging 0.81
R5894:Mx1 UTSW 16 97454206 missense probably damaging 1.00
R5916:Mx1 UTSW 16 97451733 missense probably benign 0.00
R5981:Mx1 UTSW 16 97454205 missense probably damaging 1.00
R7111:Mx1 UTSW 16 97455176 missense not run
X0028:Mx1 UTSW 16 97450421 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGTCACTAGACAAGGTGCAAACC -3'
(R):5'- CCACATGTTTGATGGAGACAGGGAG -3'

Sequencing Primer
(F):5'- CTTTGGGAAGACAGTGATGCC -3'
(R):5'- CCTGAACCTTGAAGCAAGTG -3'
Posted On2014-04-24