Incidental Mutation 'R1606:Dlc1'
ID176484
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Namedeleted in liver cancer 1
SynonymsArhgap7, A730069N07Rik, STARD12, p122-RhoGAP
MMRRC Submission 039643-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1606 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location36567751-36953143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36850252 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 423 (V423A)
Ref Sequence ENSEMBL: ENSMUSP00000132812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163663]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000036104
Predicted Effect probably benign
Transcript: ENSMUST00000163663
AA Change: V423A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: V423A

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,942,399 D1087N probably damaging Het
Abcc2 A G 19: 43,836,652 D1459G probably damaging Het
Adhfe1 G A 1: 9,553,473 probably null Het
Adsl C T 15: 80,952,224 Q61* probably null Het
Arhgap26 T A 18: 39,296,872 C214S probably damaging Het
Armc8 A T 9: 99,537,729 N9K probably damaging Het
Asxl1 A G 2: 153,400,455 D975G probably damaging Het
Atp8b3 T C 10: 80,532,578 E187G probably damaging Het
Cdcp2 T C 4: 107,102,513 S42P probably damaging Het
Chek1 A G 9: 36,719,524 L198P probably damaging Het
Dpy19l2 A G 9: 24,581,215 S696P probably benign Het
Echdc3 A T 2: 6,195,627 C183S possibly damaging Het
Exph5 A C 9: 53,374,295 D892A probably benign Het
Fam120b T A 17: 15,401,811 I17K possibly damaging Het
Fbln5 C T 12: 101,765,198 D246N probably benign Het
Fbxo15 A C 18: 84,962,620 K195T possibly damaging Het
Fzd1 C A 5: 4,757,514 E23* probably null Het
Gas2l1 C A 11: 5,064,434 A9S probably damaging Het
Gcc2 C T 10: 58,269,448 L69F probably damaging Het
Ggt6 C T 11: 72,437,733 A353V possibly damaging Het
Gm340 T G 19: 41,585,074 M756R probably benign Het
Gphn T A 12: 78,683,883 V764E probably damaging Het
Grid1 A T 14: 35,445,965 Y482F probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifit1bl1 C T 19: 34,594,044 V338M probably benign Het
Klhl14 T A 18: 21,565,532 Q408L possibly damaging Het
Lacc1 T A 14: 77,029,641 Q394L probably benign Het
Lipe A G 7: 25,388,144 F477L probably damaging Het
Lrig2 A G 3: 104,480,107 probably null Het
Megf8 T A 7: 25,358,695 H2131Q probably damaging Het
Nek1 A G 8: 61,124,276 D1097G possibly damaging Het
Nhlrc3 A T 3: 53,458,657 Y138* probably null Het
Nudcd2 T A 11: 40,736,007 probably null Het
Numb T C 12: 83,801,010 probably null Het
Olfr871 T G 9: 20,212,946 L199R probably benign Het
Pacrg G A 17: 10,839,838 Q11* probably null Het
Ppp1r37 A T 7: 19,534,999 M192K probably damaging Het
Prmt8 T A 6: 127,689,836 K392* probably null Het
Rab28 A T 5: 41,698,452 W67R probably damaging Het
Rad21l C T 2: 151,654,686 C365Y probably damaging Het
Rbm17 A T 2: 11,595,397 F147I probably benign Het
Rbm46 A C 3: 82,864,541 F256V probably damaging Het
Rcc1 A T 4: 132,334,776 probably null Het
Rnf217 G T 10: 31,534,811 T296N possibly damaging Het
Rnmt A G 18: 68,311,653 D231G possibly damaging Het
Rph3al C T 11: 75,906,541 V110I probably damaging Het
Rxfp2 T C 5: 150,059,897 M289T probably benign Het
Sash1 T C 10: 8,729,957 R890G probably benign Het
Sf3b2 A T 19: 5,287,998 D245E probably benign Het
Skint9 A T 4: 112,389,201 V238E probably benign Het
Slc26a8 T A 17: 28,638,481 D896V possibly damaging Het
Slc35b4 T A 6: 34,158,388 K330* probably null Het
Slco1a4 G T 6: 141,839,611 H84Q probably damaging Het
Sptbn2 G T 19: 4,750,242 probably null Het
St6galnac3 A T 3: 153,206,668 D227E probably benign Het
Tek G A 4: 94,849,767 D685N probably damaging Het
Trf G T 9: 103,225,136 probably null Het
Trpm5 T A 7: 143,085,171 K288* probably null Het
Ttn C T 2: 76,737,012 V27846I probably damaging Het
Tyr A T 7: 87,437,971 D444E probably benign Het
Ucp1 C A 8: 83,295,304 A255E probably damaging Het
Ush2a A G 1: 188,759,766 D3084G probably benign Het
Yeats4 T C 10: 117,217,439 Y139C probably damaging Het
Zbtb6 A G 2: 37,429,118 V266A probably benign Het
Zfp784 A T 7: 5,035,775 N261K possibly damaging Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 36570282 utr 3 prime probably benign
IGL00807:Dlc1 APN 8 36572848 missense probably benign 0.01
IGL00924:Dlc1 APN 8 36938214 missense probably benign
IGL01349:Dlc1 APN 8 36583824 missense probably damaging 0.96
IGL01419:Dlc1 APN 8 36850217 missense probably benign 0.02
IGL01871:Dlc1 APN 8 36850180 missense probably damaging 0.99
IGL01937:Dlc1 APN 8 36850191 missense probably benign 0.25
IGL02525:Dlc1 APN 8 36579646 missense probably damaging 1.00
IGL02696:Dlc1 APN 8 36574172 missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 36570275 utr 3 prime probably benign
IGL03029:Dlc1 APN 8 36571262 splice site probably null
IGL02835:Dlc1 UTSW 8 36583901 missense probably damaging 1.00
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0218:Dlc1 UTSW 8 36850229 missense probably benign
R0419:Dlc1 UTSW 8 36583586 missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 36584010 missense probably damaging 1.00
R0645:Dlc1 UTSW 8 36574049 missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 36858051 missense probably benign
R0727:Dlc1 UTSW 8 36572674 missense probably damaging 0.99
R0792:Dlc1 UTSW 8 36938548 missense probably benign 0.00
R1061:Dlc1 UTSW 8 36858051 missense probably benign
R1221:Dlc1 UTSW 8 36584831 missense probably benign
R1440:Dlc1 UTSW 8 36593463 splice site probably benign
R1501:Dlc1 UTSW 8 36938148 missense probably benign 0.06
R1707:Dlc1 UTSW 8 36937609 missense probably benign 0.03
R1750:Dlc1 UTSW 8 36858090 splice site probably null
R1762:Dlc1 UTSW 8 36937585 missense probably benign 0.25
R2041:Dlc1 UTSW 8 36582768 missense probably damaging 1.00
R2055:Dlc1 UTSW 8 36593381 missense probably damaging 0.98
R2091:Dlc1 UTSW 8 36937609 missense probably benign 0.00
R2987:Dlc1 UTSW 8 36574152 missense probably damaging 0.97
R4285:Dlc1 UTSW 8 36574128 missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 36584753 missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 36937558 critical splice donor site probably null
R4828:Dlc1 UTSW 8 36850246 missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 36584645 missense probably benign 0.01
R4902:Dlc1 UTSW 8 36577131 missense probably damaging 1.00
R5067:Dlc1 UTSW 8 36584493 missense probably benign 0.04
R5068:Dlc1 UTSW 8 36938030 missense probably benign
R5198:Dlc1 UTSW 8 36938398 missense probably damaging 1.00
R5471:Dlc1 UTSW 8 36584725 missense probably benign 0.26
R5668:Dlc1 UTSW 8 36937501 unclassified probably benign
R5915:Dlc1 UTSW 8 36938675 utr 5 prime probably benign
R6323:Dlc1 UTSW 8 36938383 missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 36572716 missense probably damaging 1.00
R6908:Dlc1 UTSW 8 36937687 missense probably benign 0.02
R6914:Dlc1 UTSW 8 36938210 missense probably benign
R6942:Dlc1 UTSW 8 36938210 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCAACAAGGACAGTAACTTACACTC -3'
(R):5'- AGGAAGTCCAGAAGGCATTTTGTTACC -3'

Sequencing Primer
(F):5'- GCAGCATACACTTTTAGGGTGAC -3'
(R):5'- ACCTATGTGATACTGAGTTCCTG -3'
Posted On2014-04-24