Incidental Mutation 'R1615:Ndfip1'
ID177080
Institutional Source Beutler Lab
Gene Symbol Ndfip1
Ensembl Gene ENSMUSG00000024425
Gene NameNedd4 family interacting protein 1
Synonyms
MMRRC Submission 039652-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R1615 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38418975-38464399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38460619 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 213 (P213S)
Ref Sequence ENSEMBL: ENSMUSP00000025293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025293]
Predicted Effect probably benign
Transcript: ENSMUST00000025293
AA Change: P213S

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025293
Gene: ENSMUSG00000024425
AA Change: P213S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:DUF2370 54 170 1.3e-11 PFAM
transmembrane domain 178 197 N/A INTRINSIC
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a small group of evolutionarily conserved proteins with three transmembrane domains. It is a potential target for ubiquitination by the Nedd4 family of proteins. This protein is thought to be part of a family of integral Golgi membrane proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele develop severe inflammation of the skin and lung due to T-cell hyperactivation and abnormal T-helper 2 physiology, and die prematurely. Mice homozygous for a null allele exhibit hypersensitivity of dopaminergic neurons to iron toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C T 9: 58,499,068 A87V probably damaging Het
Adcy8 A T 15: 64,871,776 C328S probably benign Het
Adgrv1 G T 13: 81,424,288 T4918K probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Amer3 T C 1: 34,588,171 M497T probably damaging Het
Arid2 C T 15: 96,371,654 T1216M possibly damaging Het
Birc6 A G 17: 74,609,409 probably null Het
Bzw2 A G 12: 36,119,127 probably benign Het
Ccr1 T C 9: 123,963,536 H319R probably benign Het
Dnah11 A G 12: 118,050,722 I2010T probably damaging Het
Dnhd1 A G 7: 105,703,206 Y2522C probably benign Het
Dnhd1 T A 7: 105,713,706 I3825K possibly damaging Het
Dst A T 1: 34,199,371 D3718V probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Fbxw21 T C 9: 109,143,726 Y380C probably damaging Het
Fhad1 G A 4: 141,922,323 T836M probably damaging Het
Fhod1 C T 8: 105,347,831 probably benign Het
Flt1 A G 5: 147,639,288 C637R probably damaging Het
Fmnl2 A G 2: 53,118,424 K809E probably damaging Het
Grm1 G T 10: 10,741,508 Y510* probably null Het
Hey1 A T 3: 8,664,838 H186Q possibly damaging Het
Itga2b C T 11: 102,460,137 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lmcd1 A G 6: 112,273,950 D7G probably benign Het
Lrrc1 T C 9: 77,435,118 D358G possibly damaging Het
Lyn A G 4: 3,748,765 K248E probably benign Het
Map4k4 A G 1: 40,006,830 probably benign Het
Map4k5 A T 12: 69,844,413 L160H probably damaging Het
Myo6 C T 9: 80,307,725 R1247C probably damaging Het
Myo9a A G 9: 59,788,456 E347G possibly damaging Het
Neurl3 T C 1: 36,269,389 E114G possibly damaging Het
Nlrp14 A T 7: 107,196,163 I877F probably benign Het
Obscn A G 11: 59,099,825 S1733P probably benign Het
Oxgr1 A T 14: 120,022,773 S7R probably benign Het
Plcb1 A T 2: 135,362,444 probably benign Het
Prkag2 G T 5: 24,875,178 N120K possibly damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Saraf A G 8: 34,165,288 K174E possibly damaging Het
Scrib T C 15: 76,066,205 Q264R probably benign Het
Sh3rf3 T A 10: 59,131,077 M747K probably benign Het
Shf T C 2: 122,349,432 H421R probably damaging Het
Slc35g3 A G 11: 69,760,542 S228P probably damaging Het
Slit1 A G 19: 41,650,671 probably benign Het
Soga1 T G 2: 157,020,743 H1422P probably damaging Het
Srrm4 A G 5: 116,447,300 probably benign Het
Stfa1 T G 16: 36,280,467 V23G probably damaging Het
Swap70 A G 7: 110,273,291 D371G probably benign Het
Tada2a T C 11: 84,103,100 D186G probably damaging Het
Tdpoz3 C A 3: 93,826,311 Q98K probably benign Het
Tgfbrap1 A G 1: 43,051,985 V660A probably benign Het
Tnn A G 1: 160,118,408 Y947H possibly damaging Het
Trim60 A T 8: 65,000,510 C362* probably null Het
Vmn1r81 T A 7: 12,260,514 N56Y probably damaging Het
Vsig8 A G 1: 172,559,713 D52G probably damaging Het
Wdfy4 G A 14: 33,042,512 R2140C probably damaging Het
Other mutations in Ndfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Ndfip1 APN 18 38447736 missense probably damaging 0.99
IGL02994:Ndfip1 APN 18 38452416 missense probably damaging 0.97
IGL02835:Ndfip1 UTSW 18 38456091 missense probably damaging 1.00
R4811:Ndfip1 UTSW 18 38451592 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCCTCCAGATGTAAATGTGTGGTCC -3'
(R):5'- CATGCTATCAATGCCCTACCTCCAG -3'

Sequencing Primer
(F):5'- TGAGACAAGTTAGATCCTGTGC -3'
(R):5'- ACTGAGACCCTTGCCTGTATG -3'
Posted On2014-04-24