Incidental Mutation 'R1764:Otogl'
ID193312
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 039796-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R1764 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 107899461 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 154 (W154*)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably null
Transcript: ENSMUST00000165341
AA Change: W154*
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: W154*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,478,943 I24N possibly damaging Het
4930522L14Rik A G 5: 109,736,789 V401A probably benign Het
5830411N06Rik A G 7: 140,297,265 E831G probably benign Het
9930021J03Rik T A 19: 29,719,160 T978S possibly damaging Het
Abca7 G T 10: 80,008,950 W1502L probably damaging Het
Adcy7 A G 8: 88,308,840 E124G probably benign Het
Aif1l G A 2: 31,965,106 E66K probably benign Het
Aldh8a1 A T 10: 21,395,493 M373L probably benign Het
Alg6 T C 4: 99,741,578 Y131H probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arrdc4 A T 7: 68,741,874 I215K probably damaging Het
Asb4 A G 6: 5,390,798 probably null Het
Astn1 T C 1: 158,504,251 I305T probably benign Het
Atp5b T A 10: 128,084,080 probably benign Het
Atp8a1 C A 5: 67,631,567 M1044I probably benign Het
Atp9b C T 18: 80,909,591 probably null Het
Btaf1 A G 19: 36,951,118 H113R probably benign Het
C87436 G T 6: 86,453,612 C338F possibly damaging Het
Casz1 T C 4: 148,942,900 probably benign Het
Cbr3 T A 16: 93,690,482 H184Q probably damaging Het
Cct8l1 T C 5: 25,517,099 S271P possibly damaging Het
Cdc34 A G 10: 79,685,340 K77R probably benign Het
Cdc34 G T 10: 79,685,338 probably null Het
Cdh20 A G 1: 104,934,345 probably benign Het
Celsr3 A G 9: 108,828,958 E880G probably damaging Het
Cers1 T G 8: 70,321,491 probably null Het
Cntn5 T C 9: 9,673,983 I705V probably benign Het
Dennd4c T A 4: 86,803,010 D636E probably damaging Het
Dnah11 T C 12: 118,190,825 E240G probably benign Het
Dnah2 T C 11: 69,423,543 Y4100C probably damaging Het
Dpysl3 T C 18: 43,363,518 E151G probably damaging Het
Efcab9 T G 11: 32,524,457 T9P possibly damaging Het
Eif4g2 A T 7: 111,074,487 F725Y probably damaging Het
Epha6 T A 16: 59,775,728 I867F probably null Het
Erbin T C 13: 103,843,451 probably benign Het
Evi5l A G 8: 4,203,560 E468G probably damaging Het
Filip1l C T 16: 57,570,038 R330W probably damaging Het
Fmo3 C T 1: 162,958,573 V283M possibly damaging Het
Gabarapl1 A T 6: 129,533,518 K24N possibly damaging Het
Gigyf1 C T 5: 137,522,508 probably benign Het
Gm13089 C A 4: 143,698,270 C201F probably benign Het
Gm5581 T A 6: 131,181,399 noncoding transcript Het
Gon4l G T 3: 88,892,599 K850N probably damaging Het
Igf2bp3 C T 6: 49,109,046 R233H probably damaging Het
Iqcf4 G A 9: 106,568,694 R85C probably benign Het
Kalrn C T 16: 34,212,873 R473Q probably damaging Het
Lmod2 T A 6: 24,603,377 V117E probably damaging Het
Mapk11 A G 15: 89,144,391 probably null Het
Mcm3 G A 1: 20,805,879 R664C probably damaging Het
Mex3d A G 10: 80,386,936 M162T probably benign Het
Mrgprb3 A G 7: 48,643,023 I260T probably benign Het
Ncor2 G T 5: 125,028,615 A1637D possibly damaging Het
Nedd4 T A 9: 72,730,907 D441E probably damaging Het
Nek5 A T 8: 22,109,912 C194S probably damaging Het
Nos1ap T C 1: 170,318,878 D369G possibly damaging Het
Ntrk1 G T 3: 87,780,084 T681K probably damaging Het
Olfr1306 A G 2: 111,912,181 F250L possibly damaging Het
Olfr538 T C 7: 140,574,470 W106R probably damaging Het
Pcdh20 T C 14: 88,469,184 T227A possibly damaging Het
Pcdhb17 T C 18: 37,487,271 S705P probably damaging Het
Piezo2 T C 18: 63,124,642 H335R possibly damaging Het
Pkn2 T C 3: 142,793,854 Q954R probably damaging Het
Prkcq G A 2: 11,232,631 V74M probably damaging Het
Prkrip1 A T 5: 136,189,635 probably null Het
Rb1cc1 A G 1: 6,214,680 probably benign Het
Rbm5 A T 9: 107,767,564 Y11* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr3 C A 2: 112,860,460 V1082L probably damaging Het
Sel1l3 C A 5: 53,170,447 E497* probably null Het
Serpina6 A T 12: 103,653,923 I189N probably damaging Het
Serpinb11 A T 1: 107,376,802 T166S probably benign Het
Skint7 T C 4: 111,982,073 L188S probably benign Het
Slc25a45 C T 19: 5,884,930 A269V probably damaging Het
Sltm A G 9: 70,561,800 T114A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spen C A 4: 141,472,950 V2766L probably damaging Het
Srgap2 T A 1: 131,319,537 I445F possibly damaging Het
Stox2 A T 8: 47,194,016 Y200* probably null Het
Strada C A 11: 106,164,184 R384L probably damaging Het
Tctn2 G A 5: 124,619,031 noncoding transcript Het
Tgfbr3l G T 8: 4,249,282 R461L probably benign Het
Tmem65 A G 15: 58,790,149 probably benign Het
Tpst1 G T 5: 130,114,502 V294F possibly damaging Het
Trim23 A G 13: 104,198,618 Y384C probably damaging Het
Ube3b C G 5: 114,404,617 L512V possibly damaging Het
Ubxn4 T A 1: 128,256,179 V92E probably damaging Het
Vmn2r57 A T 7: 41,400,643 C561S probably damaging Het
Vwa8 A G 14: 78,908,195 D104G probably damaging Het
Wdr25 T A 12: 109,026,438 L73* probably null Het
Wnt9a G A 11: 59,330,902 A209T probably benign Het
Zcchc17 A C 4: 130,329,595 C133G probably damaging Het
Zdhhc18 T A 4: 133,608,676 M375L probably benign Het
Zfhx3 T C 8: 108,951,644 F3109L probably benign Het
Zfp202 T A 9: 40,210,466 D286E probably benign Het
Zzef1 T C 11: 72,893,332 L2021P probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGTGCCTAAGATGCCAGTTATC -3'
(R):5'- TGCCTGTGCTGTTGTAGAACATTCC -3'

Sequencing Primer
(F):5'- CTCAGTGGGATGACACTCAATATG -3'
(R):5'- AACCTGGGGACAGTATCACT -3'
Posted On2014-05-23