Incidental Mutation 'R1778:Utrn'
ID197252
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Nameutrophin
SynonymsG-utrophin, DRP, Dmdl
MMRRC Submission 039809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1778 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location12382188-12869365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 12436364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 616 (D616Y)
Ref Sequence ENSEMBL: ENSMUSP00000151628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000217994] [ENSMUST00000218635] [ENSMUST00000219003]
Predicted Effect probably damaging
Transcript: ENSMUST00000076817
AA Change: D3090Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: D3090Y

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217994
AA Change: D647Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218635
AA Change: D3090Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219003
AA Change: D616Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.43 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G T 10: 77,982,944 A150S probably benign Het
4930432E11Rik T C 7: 29,560,706 noncoding transcript Het
4930568D16Rik A G 2: 35,354,983 M119T probably damaging Het
Aadacl2 A G 3: 60,017,450 probably null Het
Abca9 C T 11: 110,130,716 W1056* probably null Het
Adam20 A C 8: 40,796,661 T603P possibly damaging Het
Adgrl1 T C 8: 83,930,037 L323P probably damaging Het
Afap1l2 C T 19: 56,916,206 E628K possibly damaging Het
Ahctf1 A T 1: 179,753,015 L1874Q possibly damaging Het
Ak8 A G 2: 28,712,321 E89G probably benign Het
Aldh16a1 G A 7: 45,147,308 R256C probably damaging Het
Anxa5 G A 3: 36,465,331 T3M probably damaging Het
Arhgef16 T C 4: 154,287,986 K210E probably benign Het
Armc4 A T 18: 7,127,388 C942S probably damaging Het
Baz2b T C 2: 60,006,136 T18A unknown Het
BC037034 T C 5: 138,262,477 probably null Het
Bub1 A C 2: 127,803,122 I960M possibly damaging Het
Cbln2 G T 18: 86,713,147 D27Y probably benign Het
Ces2h C A 8: 105,014,607 P77Q possibly damaging Het
Chga T A 12: 102,561,700 M150K probably benign Het
Chmp3 A G 6: 71,577,807 E162G probably benign Het
Clip3 A G 7: 30,297,436 N161S probably damaging Het
Col12a1 T A 9: 79,604,585 probably benign Het
Cuedc2 C T 19: 46,331,640 G105D probably benign Het
Cyp2j7 A C 4: 96,199,390 F428V probably damaging Het
Ddx60 A G 8: 61,974,176 I762V possibly damaging Het
Def6 G A 17: 28,220,186 R257Q probably benign Het
Dkkl1 A T 7: 45,211,395 probably null Het
Dnah3 A G 7: 120,078,402 L433P probably damaging Het
Eif2s3y C T Y: 1,011,287 R33C probably benign Het
Elavl2 T A 4: 91,253,478 Y269F probably damaging Het
Esco2 A G 14: 65,831,262 S200P possibly damaging Het
Fam213b A T 4: 154,897,357 V151D probably damaging Het
Fcrl1 T A 3: 87,385,319 probably benign Het
Fhod1 C A 8: 105,329,677 D1135Y probably damaging Het
Fnbp1l T C 3: 122,590,147 N41D possibly damaging Het
Folh1 A T 7: 86,761,699 probably null Het
Fpr-rs7 T C 17: 20,114,015 D71G probably damaging Het
Gm10271 A G 10: 116,961,939 probably benign Het
Gm4841 A T 18: 60,270,948 Y24* probably null Het
Gm9825 A T 6: 7,983,124 noncoding transcript Het
Greb1 G A 12: 16,690,894 R1396C probably benign Het
Hectd1 C T 12: 51,753,807 C2076Y probably damaging Het
Hnrnpu A G 1: 178,325,241 probably benign Het
Ice2 T C 9: 69,415,648 I475T probably benign Het
Ifit1bl1 T A 19: 34,594,193 Q288L probably damaging Het
Ik T C 18: 36,756,818 probably benign Het
Kidins220 C T 12: 25,013,446 probably benign Het
Kmt2c T C 5: 25,372,974 D768G probably benign Het
Kmt2e A G 5: 23,492,364 T87A probably damaging Het
Lama5 G A 2: 180,195,481 probably benign Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Lrig2 A G 3: 104,467,366 probably benign Het
Lrig3 A G 10: 126,010,075 D791G probably damaging Het
Lrrc2 G A 9: 110,980,840 V315M probably benign Het
Lrrc4b A G 7: 44,462,399 D565G probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Msrb2 T A 2: 19,383,303 D87E probably benign Het
Muc20 T C 16: 32,794,141 T289A possibly damaging Het
Myo15 C A 11: 60,478,412 P666Q possibly damaging Het
Nfat5 C T 8: 107,361,789 P579L probably damaging Het
Nipbl A C 15: 8,319,488 M1920R probably damaging Het
Nuak1 T C 10: 84,374,874 probably null Het
Nup210l A G 3: 90,189,486 E1334G probably damaging Het
Olfr12 G A 1: 92,620,620 G238E possibly damaging Het
Olfr1410 A T 1: 92,608,109 N91Y possibly damaging Het
Olfr262 T A 19: 12,241,455 I69F probably benign Het
Olfr675 A T 7: 105,024,163 N272K probably benign Het
Olfr804 T C 10: 129,705,705 Y276H probably benign Het
P4ha3 A T 7: 100,300,691 probably null Het
Pbld2 C T 10: 63,054,371 A186V probably benign Het
Pcdh18 A T 3: 49,755,634 Y411N probably benign Het
Pgf A G 12: 85,171,767 S70P probably benign Het
Phrf1 T A 7: 141,232,456 D44E probably benign Het
Pla2g4a A G 1: 149,902,445 probably benign Het
Plce1 A G 19: 38,780,790 probably benign Het
Plxna2 A G 1: 194,810,970 N1851S probably benign Het
Prl7a2 G A 13: 27,659,271 T183I probably damaging Het
Ptger4 A T 15: 5,235,095 L335H probably damaging Het
Ptgr1 A G 4: 58,984,865 probably benign Het
Rdh7 A G 10: 127,884,721 S261P probably benign Het
Reg3a A G 6: 78,383,286 T150A probably benign Het
Rnf111 A G 9: 70,476,112 S180P probably benign Het
Rnf17 A G 14: 56,522,399 M1554V probably damaging Het
Rnf215 T A 11: 4,135,873 Y117* probably null Het
Rogdi T C 16: 5,010,505 T165A probably benign Het
Rpe65 A G 3: 159,622,848 Y431C probably damaging Het
Scube1 A G 15: 83,610,204 F844S probably damaging Het
Sdr16c6 T A 4: 4,058,814 E257D probably benign Het
Sim1 C A 10: 50,981,553 C466* probably null Het
Spi1 T A 2: 91,099,522 H46Q probably damaging Het
Sumf2 C A 5: 129,845,068 probably benign Het
Tbcb A G 7: 30,231,612 Y28H probably benign Het
Tecta C T 9: 42,343,631 C1752Y probably damaging Het
Tep1 T C 14: 50,829,622 probably benign Het
Tmem245 A T 4: 56,903,968 W591R probably damaging Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Trim13 G T 14: 61,605,619 A362S probably benign Het
Trim47 T A 11: 116,109,820 D134V probably damaging Het
Ttc26 T A 6: 38,409,476 D377E possibly damaging Het
Vnn1 G T 10: 23,899,517 A222S possibly damaging Het
Wdr17 A G 8: 54,690,214 W110R probably damaging Het
Wwp1 G T 4: 19,627,892 Y700* probably null Het
Zbtb21 T C 16: 97,950,585 S661G probably benign Het
Zfp955b A G 17: 33,302,814 K419R probably benign Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAGACAAACTCCAGATTGAAGAA -3'
(R):5'- GCCATCGCTTTTAAATTGACACTGAGAA -3'

Sequencing Primer
(F):5'- gggacagcaaagaatacacag -3'
(R):5'- TGACACTGAGAAACATCATCTTGC -3'
Posted On2014-05-23