Incidental Mutation 'R1779:Tns2'
ID197385
Institutional Source Beutler Lab
Gene Symbol Tns2
Ensembl Gene ENSMUSG00000037003
Gene Nametensin 2
Synonymsnph, nep, Tenc1
MMRRC Submission 039810-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1779 (G1)
Quality Score103
Status Validated
Chromosome15
Chromosomal Location102100413-102116401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102108934 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 281 (R281C)
Ref Sequence ENSEMBL: ENSMUSP00000155830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]
Predicted Effect probably damaging
Transcript: ENSMUST00000046144
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: R281C

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169627
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: R281C

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228958
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect probably benign
Transcript: ENSMUST00000229592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229908
Predicted Effect probably damaging
Transcript: ENSMUST00000230474
AA Change: R273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
MGI Phenotype Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,406,514 L476F probably damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
4930432E11Rik A T 7: 29,579,166 noncoding transcript Het
A930011G23Rik A T 5: 99,223,038 probably benign Het
Abcd3 A G 3: 121,781,963 Y217H probably damaging Het
Abraxas1 A T 5: 100,817,956 probably benign Het
Acsbg1 T C 9: 54,616,062 Y427C probably damaging Het
Adam10 T A 9: 70,776,369 probably benign Het
Adam24 G A 8: 40,680,965 V491I possibly damaging Het
Adamts2 T G 11: 50,756,697 V299G probably damaging Het
Adh7 A G 3: 138,223,991 T143A probably damaging Het
Ahcyl1 A G 3: 107,674,103 S81P probably benign Het
Arhgap20 C A 9: 51,849,915 T986K probably benign Het
Atp13a5 A T 16: 29,314,660 I391N possibly damaging Het
Atp6v0a1 C A 11: 101,026,685 A143E probably benign Het
Calcrl A G 2: 84,351,285 I173T probably damaging Het
Casz1 A G 4: 148,932,937 T228A probably benign Het
Cckar A G 5: 53,699,979 I292T probably damaging Het
Cfhr2 T A 1: 139,858,645 probably null Het
Chkb T C 15: 89,429,057 I109V possibly damaging Het
Clec2i T C 6: 128,888,106 probably null Het
Clec4a4 T A 6: 123,023,975 W216R probably damaging Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cp C A 3: 19,957,385 D34E possibly damaging Het
Cse1l T C 2: 166,940,124 probably null Het
Dennd3 T C 15: 73,522,508 probably null Het
Dnah7a A G 1: 53,577,223 V1193A probably benign Het
Eaf2 A G 16: 36,810,470 probably null Het
Ephb2 T C 4: 136,693,825 T405A possibly damaging Het
Fam117a G A 11: 95,378,953 V348M probably damaging Het
Fh1 T C 1: 175,601,424 *167W probably null Het
Fmo9 T A 1: 166,663,299 I486F probably benign Het
Gabbr1 T A 17: 37,054,879 I150N probably damaging Het
Gfpt1 T C 6: 87,077,197 V478A possibly damaging Het
Gm11639 T A 11: 104,720,939 S536T probably benign Het
Gm2663 A T 6: 40,997,960 V59E probably damaging Het
Gm4868 T A 5: 125,848,112 noncoding transcript Het
Heatr4 T A 12: 83,980,160 T108S probably benign Het
Hells G T 19: 38,946,842 A319S probably benign Het
Helz2 A G 2: 181,234,987 V1238A probably benign Het
Helz2 T A 2: 181,238,459 Q488L possibly damaging Het
Hkdc1 A G 10: 62,391,383 F765S probably damaging Het
Hspg2 T A 4: 137,518,509 W938R probably damaging Het
Itpr2 G A 6: 146,158,901 R2473* probably null Het
Kctd1 C T 18: 15,061,782 V595I probably benign Het
Krt7 A G 15: 101,423,409 Y369C probably damaging Het
Krt72 T C 15: 101,780,929 T323A probably benign Het
Krt76 A G 15: 101,892,687 L58P unknown Het
Liph C A 16: 21,968,050 R272L probably benign Het
Lrrc9 A T 12: 72,455,998 K248* probably null Het
Mei4 T A 9: 81,927,142 S93T probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Myo5b A G 18: 74,742,147 M1541V probably benign Het
Napg A G 18: 62,982,691 E66G probably benign Het
Npr3 T C 15: 11,851,486 D406G probably damaging Het
Nr2c2 A G 6: 92,159,243 T355A possibly damaging Het
Olfr1243 A T 2: 89,527,645 I255K probably benign Het
Olfr1461 T C 19: 13,165,040 Y9H probably benign Het
Olfr26 A G 9: 38,855,550 M163V possibly damaging Het
Olfr618 A T 7: 103,597,900 I195F probably damaging Het
Olfr624 A G 7: 103,670,638 I131T probably benign Het
Olfr631 G T 7: 103,929,461 V213L probably benign Het
Olfr71 G A 4: 43,706,041 H176Y probably damaging Het
Orai2 T C 5: 136,150,939 E80G probably damaging Het
Pcdhb14 T A 18: 37,449,482 V547E probably damaging Het
Pcdhb15 T C 18: 37,476,031 I772T possibly damaging Het
Pcnt T C 10: 76,408,796 Q1150R probably damaging Het
Pdcd6 A G 13: 74,305,581 I146T probably damaging Het
Phldb2 T A 16: 45,801,625 D664V probably damaging Het
Pik3ap1 A T 19: 41,332,234 V182E probably damaging Het
Pip4k2a A G 2: 18,847,622 V283A probably benign Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Pnpla6 T C 8: 3,541,404 W1151R probably damaging Het
Ppp1r14c A G 10: 3,366,890 Y75C probably damaging Het
Prl2b1 C T 13: 27,383,469 D224N probably benign Het
Ptgis A G 2: 167,214,858 S270P probably benign Het
Rgs11 C A 17: 26,210,666 A446D probably damaging Het
Rims2 A G 15: 39,681,702 T1531A probably damaging Het
Sbno1 A T 5: 124,388,517 probably benign Het
Scarb2 C G 5: 92,448,557 M409I probably benign Het
Scube3 C T 17: 28,168,379 probably benign Het
Slc44a4 T C 17: 34,921,925 I180T probably damaging Het
Slc9a2 T C 1: 40,742,643 M344T probably damaging Het
Smc3 A T 19: 53,639,369 T860S probably benign Het
Snrpa A G 7: 27,191,749 I99T probably benign Het
Sorcs1 A G 19: 50,175,043 probably benign Het
Sorl1 C T 9: 41,991,482 probably null Het
Suds3 T C 5: 117,105,244 K143R probably benign Het
Supt20 A T 3: 54,714,743 M424L probably benign Het
Tgtp2 T C 11: 49,058,924 M274V probably benign Het
Tmem158 T A 9: 123,259,909 M213L probably benign Het
Tnks C A 8: 34,857,518 R639L probably benign Het
Trmt10c A C 16: 56,034,575 N232K possibly damaging Het
Trpm6 C T 19: 18,856,217 R1587W probably damaging Het
Trrap G A 5: 144,828,590 V2539I probably benign Het
Tsg101 A G 7: 46,907,087 S115P probably benign Het
Ttll13 G T 7: 80,260,508 V800L probably benign Het
Vmn1r57 A G 7: 5,220,577 T34A possibly damaging Het
Vmn2r118 T A 17: 55,611,530 T121S probably benign Het
Wdr35 A G 12: 8,985,772 I238M possibly damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Zfp81 T A 17: 33,335,106 T245S probably benign Het
Zfyve26 G T 12: 79,278,463 P824Q probably damaging Het
Other mutations in Tns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Tns2 APN 15 102113191 missense probably damaging 1.00
IGL01935:Tns2 APN 15 102111634 unclassified probably null
IGL01994:Tns2 APN 15 102111379 missense possibly damaging 0.81
IGL02025:Tns2 APN 15 102112049 nonsense probably null
IGL02135:Tns2 APN 15 102113026 missense probably damaging 1.00
IGL02355:Tns2 APN 15 102112290 missense probably benign
IGL02362:Tns2 APN 15 102112290 missense probably benign
IGL02439:Tns2 APN 15 102114543 missense probably damaging 1.00
IGL02488:Tns2 APN 15 102112743 missense probably benign
IGL02546:Tns2 APN 15 102110940 missense probably damaging 1.00
IGL02616:Tns2 APN 15 102111415 missense probably benign
IGL02628:Tns2 APN 15 102111828 missense probably benign 0.04
IGL02658:Tns2 APN 15 102107796 splice site probably benign
IGL03267:Tns2 APN 15 102105378 critical splice donor site probably null
P0005:Tns2 UTSW 15 102114056 missense probably damaging 0.98
R0586:Tns2 UTSW 15 102109585 splice site probably benign
R0791:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0817:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0818:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0819:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0820:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1451:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1454:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1455:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1487:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1510:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1579:Tns2 UTSW 15 102111210 missense probably damaging 1.00
R1698:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1772:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1843:Tns2 UTSW 15 102113133 unclassified probably null
R1923:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1924:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1927:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1980:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2051:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2087:Tns2 UTSW 15 102107119 missense possibly damaging 0.70
R2100:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2103:Tns2 UTSW 15 102112665 critical splice acceptor site probably null
R2105:Tns2 UTSW 15 102107506 missense probably benign 0.27
R2224:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2225:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2227:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2252:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2253:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2290:Tns2 UTSW 15 102112023 missense probably damaging 0.99
R2304:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2318:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2446:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2447:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2448:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2566:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2567:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2897:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2898:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3159:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3160:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3196:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3237:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3426:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3427:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3428:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3695:Tns2 UTSW 15 102112749 missense probably null
R3767:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3911:Tns2 UTSW 15 102113837 critical splice donor site probably null
R4113:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4157:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4394:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4395:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4396:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4439:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4441:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4537:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4538:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4541:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4599:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4600:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4602:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4773:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4774:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4775:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4776:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4880:Tns2 UTSW 15 102112039 missense probably damaging 0.98
R4989:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5014:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5058:Tns2 UTSW 15 102107860 missense possibly damaging 0.68
R5253:Tns2 UTSW 15 102111453 missense probably damaging 1.00
R5336:Tns2 UTSW 15 102111229 missense probably damaging 1.00
R5351:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5629:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5630:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5631:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5685:Tns2 UTSW 15 102107103 missense probably benign 0.02
R5844:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6048:Tns2 UTSW 15 102111411 missense probably damaging 1.00
R6067:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6079:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6130:Tns2 UTSW 15 102111241 missense probably damaging 1.00
R6136:Tns2 UTSW 15 102107030 missense probably damaging 1.00
R6138:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6199:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6210:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6426:Tns2 UTSW 15 102107037 missense possibly damaging 0.65
R6544:Tns2 UTSW 15 102113834 missense possibly damaging 0.93
R6594:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6596:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6734:Tns2 UTSW 15 102103116 missense probably damaging 0.96
U15987:Tns2 UTSW 15 102108934 missense probably damaging 1.00
X0009:Tns2 UTSW 15 102112465 missense possibly damaging 0.94
X0026:Tns2 UTSW 15 102110502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTGACAAGCGAGGAAAGCCAG -3'
(R):5'- GTGCCAAGAAAGCATCAGCGTC -3'

Sequencing Primer
(F):5'- CCGGGAAACTGACTATGCTG -3'
(R):5'- cagaccttatcgccagcc -3'
Posted On2014-05-23