Incidental Mutation 'R3160:Tns2'
ID258123
Institutional Source Beutler Lab
Gene Symbol Tns2
Ensembl Gene ENSMUSG00000037003
Gene Nametensin 2
Synonymsnph, nep, Tenc1
MMRRC Submission 040611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3160 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102100413-102116401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102113336 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1118 (E1118G)
Ref Sequence ENSEMBL: ENSMUSP00000041087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000154032] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000230474]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046144
AA Change: E1118G

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: E1118G

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139279
Predicted Effect probably benign
Transcript: ENSMUST00000154032
SMART Domains Protein: ENSMUSP00000121493
Gene: ENSMUSG00000036966

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
SPRY 76 201 1.66e-11 SMART
SPRY 256 441 3.28e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169627
AA Change: E1111G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: E1111G

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228958
AA Change: E1111G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229800
Predicted Effect possibly damaging
Transcript: ENSMUST00000230474
AA Change: E1103G

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Other mutations in Tns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Tns2 APN 15 102113191 missense probably damaging 1.00
IGL01935:Tns2 APN 15 102111634 unclassified probably null
IGL01994:Tns2 APN 15 102111379 missense possibly damaging 0.81
IGL02025:Tns2 APN 15 102112049 nonsense probably null
IGL02135:Tns2 APN 15 102113026 missense probably damaging 1.00
IGL02355:Tns2 APN 15 102112290 missense probably benign
IGL02362:Tns2 APN 15 102112290 missense probably benign
IGL02439:Tns2 APN 15 102114543 missense probably damaging 1.00
IGL02488:Tns2 APN 15 102112743 missense probably benign
IGL02546:Tns2 APN 15 102110940 missense probably damaging 1.00
IGL02616:Tns2 APN 15 102111415 missense probably benign
IGL02628:Tns2 APN 15 102111828 missense probably benign 0.04
IGL02658:Tns2 APN 15 102107796 splice site probably benign
IGL03267:Tns2 APN 15 102105378 critical splice donor site probably null
P0005:Tns2 UTSW 15 102114056 missense probably damaging 0.98
R0586:Tns2 UTSW 15 102109585 splice site probably benign
R0791:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0817:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0818:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0819:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0820:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1451:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1454:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1455:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1487:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1510:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1579:Tns2 UTSW 15 102111210 missense probably damaging 1.00
R1698:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1772:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1779:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1843:Tns2 UTSW 15 102113133 unclassified probably null
R1923:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1924:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1927:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1980:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2051:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2087:Tns2 UTSW 15 102107119 missense possibly damaging 0.70
R2100:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2103:Tns2 UTSW 15 102112665 critical splice acceptor site probably null
R2105:Tns2 UTSW 15 102107506 missense probably benign 0.27
R2224:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2225:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2227:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2252:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2253:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2290:Tns2 UTSW 15 102112023 missense probably damaging 0.99
R2304:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2318:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2446:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2447:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2448:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2566:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2567:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2897:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2898:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3159:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3196:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3237:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3426:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3427:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3428:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3695:Tns2 UTSW 15 102112749 missense probably null
R3767:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3911:Tns2 UTSW 15 102113837 critical splice donor site probably null
R4113:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4157:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4394:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4395:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4396:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4439:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4441:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4537:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4538:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4541:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4599:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4600:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4602:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4773:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4774:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4775:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4776:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4880:Tns2 UTSW 15 102112039 missense probably damaging 0.98
R4989:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5014:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5058:Tns2 UTSW 15 102107860 missense possibly damaging 0.68
R5253:Tns2 UTSW 15 102111453 missense probably damaging 1.00
R5336:Tns2 UTSW 15 102111229 missense probably damaging 1.00
R5351:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5629:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5630:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5631:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5685:Tns2 UTSW 15 102107103 missense probably benign 0.02
R5844:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6048:Tns2 UTSW 15 102111411 missense probably damaging 1.00
R6067:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6079:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6130:Tns2 UTSW 15 102111241 missense probably damaging 1.00
R6136:Tns2 UTSW 15 102107030 missense probably damaging 1.00
R6138:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6199:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6210:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6426:Tns2 UTSW 15 102107037 missense possibly damaging 0.65
R6544:Tns2 UTSW 15 102113834 missense possibly damaging 0.93
R6594:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6596:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6734:Tns2 UTSW 15 102103116 missense probably damaging 0.96
U15987:Tns2 UTSW 15 102108934 missense probably damaging 1.00
X0009:Tns2 UTSW 15 102112465 missense possibly damaging 0.94
X0026:Tns2 UTSW 15 102110502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTCCCATTCAGCCTC -3'
(R):5'- ACCAGGATAATGGGCTTACAGC -3'

Sequencing Primer
(F):5'- AAACGACACCTGCCTGGGTC -3'
(R):5'- CCAAGACAGGCCTGGGAGATG -3'
Posted On2015-01-23