Incidental Mutation 'R0092:Hipk2'
ID20273
Institutional Source Beutler Lab
Gene Symbol Hipk2
Ensembl Gene ENSMUSG00000061436
Gene Namehomeodomain interacting protein kinase 2
Synonyms1110014O20Rik, Stank, B230339E18Rik
MMRRC Submission 038379-MU
Accession Numbers

Ncbi RefSeq: NM_001136065.1, NM_010433.2; MGI: 1314872

Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R0092 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location38694390-38876165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38743229 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 482 (D482G)
Ref Sequence ENSEMBL: ENSMUSP00000125572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159894
Predicted Effect probably damaging
Transcript: ENSMUST00000160360
AA Change: D489G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436
AA Change: D489G

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160962
AA Change: D482G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436
AA Change: D482G

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161779
AA Change: D489G

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436
AA Change: D489G

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162359
AA Change: D489G

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436
AA Change: D489G

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype Strain: 3624127; 3487301; 4429497
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,028,159 D3790G probably benign Het
Abcg2 T A 6: 58,685,777 S535T probably benign Het
Acad11 A T 9: 104,090,341 probably benign Het
Acadm A T 3: 153,941,875 probably benign Het
Acot12 T A 13: 91,741,565 M12K probably damaging Het
Actr2 A T 11: 20,094,308 N99K probably benign Het
Adam2 G A 14: 66,053,887 A314V probably damaging Het
Aes G A 10: 81,561,220 G10D possibly damaging Het
Agl C T 3: 116,793,804 R34Q probably damaging Het
Agrn C T 4: 156,178,953 R338H probably damaging Het
AI661453 A G 17: 47,467,515 probably benign Het
Alpk3 A G 7: 81,092,553 D706G probably benign Het
Apbb1 T C 7: 105,559,154 E648G probably damaging Het
Astn2 C A 4: 66,403,982 A127S unknown Het
Asxl2 T C 12: 3,496,313 S366P probably benign Het
Bdh1 A T 16: 31,447,562 K92* probably null Het
Cacna1g C T 11: 94,457,264 S666N probably damaging Het
Ces2b A G 8: 104,836,512 T361A possibly damaging Het
Col6a4 T A 9: 106,013,314 E1927V probably benign Het
Ctnnb1 T G 9: 120,952,863 I314S possibly damaging Het
Cyp2c66 T C 19: 39,183,780 probably benign Het
Dennd4c T A 4: 86,781,607 F232I probably damaging Het
Dennd5a T C 7: 109,899,806 N950S possibly damaging Het
Dhx30 T C 9: 110,085,010 N14S possibly damaging Het
Dip2b T A 15: 100,202,265 V1004D probably damaging Het
Dnah1 A C 14: 31,271,609 S2872A probably benign Het
Dnajc10 T C 2: 80,325,682 V233A probably damaging Het
E230025N22Rik A G 18: 36,689,224 L162P probably damaging Het
Elmod3 T C 6: 72,566,809 D333G probably benign Het
Epb41l3 T A 17: 69,286,750 M846K probably damaging Het
Frem2 A G 3: 53,589,796 Y1766H probably benign Het
Fxr2 T C 11: 69,642,146 probably benign Het
Gm14085 G T 2: 122,517,597 probably benign Het
Gm9833 G A 3: 10,088,573 C134Y possibly damaging Het
Gmpr2 A G 14: 55,677,945 R258G probably benign Het
Helb T C 10: 120,089,808 Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,090,603 probably null Het
Itgb4 G T 11: 115,979,124 R44L probably damaging Het
Itih1 T C 14: 30,940,863 probably benign Het
Kit T A 5: 75,647,754 S719R possibly damaging Het
Krt13 G A 11: 100,121,432 Q22* probably null Het
L3mbtl4 A C 17: 68,425,703 R59S probably benign Het
Lpp A G 16: 24,761,602 S23G probably benign Het
Magi3 G A 3: 104,050,964 Q602* probably null Het
Man2a1 A G 17: 64,659,084 probably benign Het
Muc5ac A G 7: 141,818,630 E2667G possibly damaging Het
Myo15b C G 11: 115,862,986 S842C possibly damaging Het
Naf1 T A 8: 66,889,108 S462T probably benign Het
Necab3 T C 2: 154,558,739 D34G possibly damaging Het
Nisch C A 14: 31,191,453 probably benign Het
Nlrc5 T C 8: 94,489,594 probably benign Het
Nmt1 T C 11: 103,046,493 F119L probably damaging Het
Nod1 T G 6: 54,944,541 D264A probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nt5e T A 9: 88,370,285 F567I probably benign Het
Obscn A T 11: 59,051,247 M4434K possibly damaging Het
Olfr119 T G 17: 37,700,805 L45R probably damaging Het
Olfr50 A G 2: 36,793,496 T87A probably benign Het
Olfr512 T C 7: 108,713,824 V145A probably benign Het
Olfr632 T C 7: 103,937,727 S116P probably damaging Het
Olfr796 A G 10: 129,608,221 S87P probably damaging Het
Opa1 A T 16: 29,625,594 D866V probably damaging Het
Otop1 T A 5: 38,299,830 V311E probably damaging Het
Pcsk2 A G 2: 143,801,024 D407G probably damaging Het
Pdcd1 A G 1: 94,052,424 W23R possibly damaging Het
Pigp A G 16: 94,365,462 V129A probably damaging Het
Pik3r5 A G 11: 68,492,803 R483G probably benign Het
Pink1 A G 4: 138,319,998 V225A probably benign Het
Plcl1 C G 1: 55,696,765 Q422E probably damaging Het
Plec T C 15: 76,183,743 E1222G probably benign Het
Polr1a T C 6: 71,967,455 probably benign Het
Prokr2 C T 2: 132,373,597 V154M probably damaging Het
Rasgrp4 A G 7: 29,145,132 R280G possibly damaging Het
Rmnd5b T C 11: 51,629,592 E8G possibly damaging Het
Sbf2 T A 7: 110,320,806 probably benign Het
Sec23b A G 2: 144,566,910 M172V probably benign Het
Setx T C 2: 29,146,293 V930A probably benign Het
Sft2d2 G A 1: 165,179,260 A159V possibly damaging Het
Sh3gl1 G T 17: 56,018,088 R250S probably benign Het
Skor1 C A 9: 63,145,995 D231Y probably damaging Het
Slc24a1 T G 9: 64,948,752 E291A unknown Het
Smc1b A T 15: 85,067,724 probably benign Het
Tbccd1 A T 16: 22,826,094 N177K possibly damaging Het
Tdp1 T A 12: 99,954,989 Y595N probably damaging Het
Tmem108 T C 9: 103,489,305 K496E possibly damaging Het
Tmprss7 T C 16: 45,667,596 D490G probably damaging Het
Tnrc6b A T 15: 80,918,528 N1511Y probably damaging Het
Top2b G A 14: 16,409,263 R802Q probably damaging Het
Trip10 A T 17: 57,250,798 K27N possibly damaging Het
Txlnb A G 10: 17,842,755 N445D possibly damaging Het
Txnrd1 T A 10: 82,879,802 I159N probably damaging Het
Ulk1 C A 5: 110,796,327 A164S probably null Het
Vmn2r83 T C 10: 79,491,964 V802A probably damaging Het
Zbtb4 A G 11: 69,779,351 I967V probably benign Het
Other mutations in Hipk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Hipk2 APN 6 38819322 splice site probably benign
IGL00814:Hipk2 APN 6 38818549 missense probably damaging 1.00
IGL00907:Hipk2 APN 6 38818273 missense probably damaging 1.00
IGL01350:Hipk2 APN 6 38818315 missense probably damaging 1.00
IGL01714:Hipk2 APN 6 38819182 missense probably damaging 1.00
IGL01893:Hipk2 APN 6 38818395 missense probably benign 0.05
IGL02028:Hipk2 APN 6 38818756 missense possibly damaging 0.67
IGL02133:Hipk2 APN 6 38819134 missense probably benign
IGL02135:Hipk2 APN 6 38818999 missense possibly damaging 0.90
IGL02543:Hipk2 APN 6 38703501 missense possibly damaging 0.95
IGL02630:Hipk2 APN 6 38818521 missense possibly damaging 0.48
IGL02896:Hipk2 APN 6 38698447 missense probably damaging 1.00
IGL02900:Hipk2 APN 6 38729944 missense probably damaging 0.96
IGL03345:Hipk2 APN 6 38748002 splice site probably benign
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0184:Hipk2 UTSW 6 38718931 missense possibly damaging 0.77
R0494:Hipk2 UTSW 6 38729989 missense probably benign 0.03
R0617:Hipk2 UTSW 6 38747485 missense possibly damaging 0.70
R0720:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R1812:Hipk2 UTSW 6 38698163 missense probably benign 0.14
R1864:Hipk2 UTSW 6 38718935 critical splice acceptor site probably null
R1919:Hipk2 UTSW 6 38818984 nonsense probably null
R1995:Hipk2 UTSW 6 38715974 missense probably damaging 1.00
R2079:Hipk2 UTSW 6 38818785 missense probably damaging 1.00
R2238:Hipk2 UTSW 6 38729915 splice site probably benign
R2384:Hipk2 UTSW 6 38818371 missense probably damaging 0.99
R3775:Hipk2 UTSW 6 38743094 missense probably damaging 0.99
R3792:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R3841:Hipk2 UTSW 6 38818926 missense probably damaging 1.00
R3883:Hipk2 UTSW 6 38699265 missense probably damaging 1.00
R4471:Hipk2 UTSW 6 38736922 intron probably benign
R4724:Hipk2 UTSW 6 38698392 missense probably benign 0.10
R4838:Hipk2 UTSW 6 38818404 missense possibly damaging 0.94
R4843:Hipk2 UTSW 6 38819257 missense possibly damaging 0.94
R5040:Hipk2 UTSW 6 38730881 missense possibly damaging 0.82
R5044:Hipk2 UTSW 6 38818879 missense probably benign 0.06
R5320:Hipk2 UTSW 6 38818277 missense probably damaging 1.00
R5409:Hipk2 UTSW 6 38730042 missense probably damaging 1.00
R5682:Hipk2 UTSW 6 38737473 missense possibly damaging 0.50
R5695:Hipk2 UTSW 6 38818875 missense possibly damaging 0.64
R5876:Hipk2 UTSW 6 38730867 critical splice donor site probably null
R6309:Hipk2 UTSW 6 38698511 missense probably damaging 1.00
R6612:Hipk2 UTSW 6 38818873 missense probably benign 0.04
R6815:Hipk2 UTSW 6 38818842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCACTTACTGGGCACTATGGG -3'
(R):5'- GTGTGATGAAAGCTGCACTTCACC -3'

Sequencing Primer
(F):5'- CACTATGGGGGAAGTCAAGC -3'
(R):5'- CCATTCTGTTCCTAGCGTATAAGAGG -3'
Protein Function and Prediction

Homeodomain interacting protein kinase 2 (Hipk2) is a conserved serine/threonine kinase that interacts with and phosphorylates homeodomain transcription factors to regulate transcription during development and in response to DNA damage (1). Hipk2 has a conserved N-terminal kinase domain with a DYRK motif, a nuclear localization sequence, a PEST domain, and C-terminal region that contains speckle-retention signal, an autoinhibitory domain, and a ubiquitylation site (1;2).

 

Northern blot analysis detected ubiquitous expression of a 11.0-kb HIPK2 transcript, with strongest expression in human neuronal tissue; a 7.8-kb transcript was detected in the uterus and a 1.4-kb transcript was detected in the pancreas (3). Hipk2 is detectable in postnatal day (P) 15 mouse embryos and is strong by P17 (4).  In situ hybridization detected expression in neural retina, telencephalon, and muscle at P16.5 (4). Similar to human HIPK2, mouse Hipk2 is ubiquitously expressed in the adult, Pierantoni et al. detected highest expression in the heart, muscle and kidney by RT-PCR (4).

 

Hipk2tm1Hko/tm1Hko; MGI:3624127

involves: C57BL/6

Embyronic fibroblasts from null mice are slightly resistant to UV radiation (5). Also, there are more frequent instances of neural tube defects in these mice (5).

 

Hipk2tm1Ejh/tm1Ejh; MGI:3487301

involves: 129X1/SvJ * C57BL/6

Homozygous mice exhibit diminished locomotor activity response to amphetamine compared with wild-type mice as well as abnormal limb grasping, impaired coordination, abnormal voluntary movement, and abnormal gait (6).  There is also decreased neuron apoptosis in dopaminergic neurons at E17.5 and P0 (6). Homozygotes have decreased dopaminergic neuron number throughout life (6).

 

Hipk2tm1Ejh/tm1Ejh; MGI:3487301

involves: 129X1/SvJ * C57BL/6J

In this genetic background, homozygotes have more neurons in the trigeminal ganglion at E13.5 and P0 due to a reduction in apoptotic neurons (7).

 

Hipk2tm1Afus/tm1Afus; MGI:4429497

involves: 129X1/SvJ * C57BL/6

Homozygotes in this model have abnormal motor capabilities/coordination/movement as well as an increase in the number of mouse embryonic fibroblasts in the G0/G1 phase of the cell cycle and reduced proliferation (8). Homozygotes have decreased birth and body weight over their life (8).

References
Posted On2013-04-11
Science WriterAnne Murray