Incidental Mutation 'R1812:Hipk2'
ID202462
Institutional Source Beutler Lab
Gene Symbol Hipk2
Ensembl Gene ENSMUSG00000061436
Gene Namehomeodomain interacting protein kinase 2
Synonyms1110014O20Rik, Stank, B230339E18Rik
MMRRC Submission 039840-MU
Accession Numbers

Ncbi RefSeq: NM_001136065.1, NM_010433.2; MGI: 1314872

Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location38694390-38876165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38698163 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1188 (A1188V)
Ref Sequence ENSEMBL: ENSMUSP00000124133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]
Predicted Effect probably benign
Transcript: ENSMUST00000160360
AA Change: A1160V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436
AA Change: A1160V

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160962
AA Change: A1153V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436
AA Change: A1153V

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161779
AA Change: A1188V

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436
AA Change: A1188V

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162359
AA Change: A1161V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436
AA Change: A1161V

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype Strain: 3624127; 3487301; 4429497
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Hipk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Hipk2 APN 6 38819322 splice site probably benign
IGL00814:Hipk2 APN 6 38818549 missense probably damaging 1.00
IGL00907:Hipk2 APN 6 38818273 missense probably damaging 1.00
IGL01350:Hipk2 APN 6 38818315 missense probably damaging 1.00
IGL01714:Hipk2 APN 6 38819182 missense probably damaging 1.00
IGL01893:Hipk2 APN 6 38818395 missense probably benign 0.05
IGL02028:Hipk2 APN 6 38818756 missense possibly damaging 0.67
IGL02133:Hipk2 APN 6 38819134 missense probably benign
IGL02135:Hipk2 APN 6 38818999 missense possibly damaging 0.90
IGL02543:Hipk2 APN 6 38703501 missense possibly damaging 0.95
IGL02630:Hipk2 APN 6 38818521 missense possibly damaging 0.48
IGL02896:Hipk2 APN 6 38698447 missense probably damaging 1.00
IGL02900:Hipk2 APN 6 38729944 missense probably damaging 0.96
IGL03345:Hipk2 APN 6 38748002 splice site probably benign
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0092:Hipk2 UTSW 6 38743229 missense probably damaging 0.97
R0184:Hipk2 UTSW 6 38718931 missense possibly damaging 0.77
R0494:Hipk2 UTSW 6 38729989 missense probably benign 0.03
R0617:Hipk2 UTSW 6 38747485 missense possibly damaging 0.70
R0720:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R1864:Hipk2 UTSW 6 38718935 critical splice acceptor site probably null
R1919:Hipk2 UTSW 6 38818984 nonsense probably null
R1995:Hipk2 UTSW 6 38715974 missense probably damaging 1.00
R2079:Hipk2 UTSW 6 38818785 missense probably damaging 1.00
R2238:Hipk2 UTSW 6 38729915 splice site probably benign
R2384:Hipk2 UTSW 6 38818371 missense probably damaging 0.99
R3775:Hipk2 UTSW 6 38743094 missense probably damaging 0.99
R3792:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R3841:Hipk2 UTSW 6 38818926 missense probably damaging 1.00
R3883:Hipk2 UTSW 6 38699265 missense probably damaging 1.00
R4471:Hipk2 UTSW 6 38736922 intron probably benign
R4724:Hipk2 UTSW 6 38698392 missense probably benign 0.10
R4838:Hipk2 UTSW 6 38818404 missense possibly damaging 0.94
R4843:Hipk2 UTSW 6 38819257 missense possibly damaging 0.94
R5040:Hipk2 UTSW 6 38730881 missense possibly damaging 0.82
R5044:Hipk2 UTSW 6 38818879 missense probably benign 0.06
R5320:Hipk2 UTSW 6 38818277 missense probably damaging 1.00
R5409:Hipk2 UTSW 6 38730042 missense probably damaging 1.00
R5682:Hipk2 UTSW 6 38737473 missense possibly damaging 0.50
R5695:Hipk2 UTSW 6 38818875 missense possibly damaging 0.64
R5876:Hipk2 UTSW 6 38730867 critical splice donor site probably null
R6309:Hipk2 UTSW 6 38698511 missense probably damaging 1.00
R6612:Hipk2 UTSW 6 38818873 missense probably benign 0.04
R6815:Hipk2 UTSW 6 38818842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCATTTGTGCCCCGAC -3'
(R):5'- TACATCACTCCGACCATGGC -3'

Sequencing Primer
(F):5'- TTGTGCCCCGACTGCCC -3'
(R):5'- AGCCATGGCACTGTTCAC -3'
Posted On2014-06-23