Incidental Mutation 'R1884:Nudt6'
ID209330
Institutional Source Beutler Lab
Gene Symbol Nudt6
Ensembl Gene ENSMUSG00000050174
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 6
Synonyms
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location37404910-37420211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37412400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 82 (V82A)
Ref Sequence ENSEMBL: ENSMUSP00000103753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052645] [ENSMUST00000099130] [ENSMUST00000108117] [ENSMUST00000108118] [ENSMUST00000141438] [ENSMUST00000146324] [ENSMUST00000149449] [ENSMUST00000200585]
Predicted Effect probably benign
Transcript: ENSMUST00000052645
AA Change: V150A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056219
Gene: ENSMUSG00000050174
AA Change: V150A

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 270 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099130
AA Change: V150A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096733
Gene: ENSMUSG00000050174
AA Change: V150A

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 269 7.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108117
SMART Domains Protein: ENSMUSP00000103752
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108118
AA Change: V82A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103753
Gene: ENSMUSG00000050174
AA Change: V82A

DomainStartEndE-ValueType
Pfam:NUDIX 73 202 1.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133894
Predicted Effect unknown
Transcript: ENSMUST00000138949
AA Change: V116A
SMART Domains Protein: ENSMUSP00000118428
Gene: ENSMUSG00000050174
AA Change: V116A

DomainStartEndE-ValueType
PDB:3FXT|H 17 98 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000141438
SMART Domains Protein: ENSMUSP00000142588
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3H95|A 2 97 5e-55 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000146324
SMART Domains Protein: ENSMUSP00000142653
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
Pfam:NUDIX 1 104 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149449
SMART Domains Protein: ENSMUSP00000116572
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 3e-44 PDB
PDB:3H95|A 132 191 6e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198158
Predicted Effect probably benign
Transcript: ENSMUST00000200585
SMART Domains Protein: ENSMUSP00000143094
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Nudt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Nudt6 APN 3 37405171 missense probably benign 0.03
IGL02965:Nudt6 APN 3 37419506 missense probably damaging 0.99
IGL02975:Nudt6 APN 3 37419518 missense probably damaging 1.00
R0927:Nudt6 UTSW 3 37405353 missense probably benign 0.01
R1939:Nudt6 UTSW 3 37405230 missense probably damaging 1.00
R2122:Nudt6 UTSW 3 37412405 missense probably benign 0.01
R4416:Nudt6 UTSW 3 37405229 unclassified probably null
R4801:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R4802:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R5826:Nudt6 UTSW 3 37419468 missense probably benign 0.05
R6362:Nudt6 UTSW 3 37419489 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GACAGGTTTAGGTCTGTGTCAC -3'
(R):5'- TGAGTAATGACCTCCTTGCTGG -3'

Sequencing Primer
(F):5'- GGTATCTAGATGTCCCATAACTGC -3'
(R):5'- GAGAGGTGTTTTATAGTCTTCATGAC -3'
Posted On2014-06-30