Incidental Mutation 'R1884:Vipr1'
ID209364
Institutional Source Beutler Lab
Gene Symbol Vipr1
Ensembl Gene ENSMUSG00000032528
Gene Namevasoactive intestinal peptide receptor 1
SynonymsVPAC1, VIP-R1, VIP receptor subtype 1
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location121642716-121672954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121665864 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 327 (P327L)
Ref Sequence ENSEMBL: ENSMUSP00000035115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035115
AA Change: P327L

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035115
Gene: ENSMUSG00000032528
AA Change: P327L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
HormR 59 131 7.38e-26 SMART
Pfam:7tm_2 140 386 1.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149959
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with severe neonatal growth failure, enlarged cecum, intestinal hemorrhage, and enterocyte hyperproliferation in addition to disorganized islets and impaired glucose homeostasisin surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Vps13b A T 15: 35,430,291 probably benign Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Vipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Vipr1 APN 9 121665178 missense probably damaging 0.99
IGL01779:Vipr1 APN 9 121664630 missense probably damaging 1.00
IGL01809:Vipr1 APN 9 121661440 missense possibly damaging 0.70
IGL02250:Vipr1 APN 9 121665189 missense probably benign 0.10
IGL02677:Vipr1 APN 9 121660283 splice site probably benign
bernalillo UTSW 9 121664618 missense probably damaging 1.00
R0036:Vipr1 UTSW 9 121660983 missense probably benign
R0514:Vipr1 UTSW 9 121658049 missense probably damaging 1.00
R0629:Vipr1 UTSW 9 121660171 nonsense probably null
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1766:Vipr1 UTSW 9 121661419 missense possibly damaging 0.87
R1945:Vipr1 UTSW 9 121668474 missense probably damaging 1.00
R1945:Vipr1 UTSW 9 121668475 missense probably damaging 1.00
R2366:Vipr1 UTSW 9 121665184 missense probably benign 0.19
R4275:Vipr1 UTSW 9 121664618 missense probably damaging 1.00
R4600:Vipr1 UTSW 9 121665136 splice site probably null
R5012:Vipr1 UTSW 9 121658045 critical splice acceptor site probably null
R6190:Vipr1 UTSW 9 121664653 missense probably damaging 1.00
R6376:Vipr1 UTSW 9 121664574 missense probably damaging 1.00
R6473:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
R6476:Vipr1 UTSW 9 121669423 missense probably benign 0.28
R6641:Vipr1 UTSW 9 121669565 makesense probably null
R6752:Vipr1 UTSW 9 121653893 missense probably damaging 0.99
R7189:Vipr1 UTSW 9 121664554 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAGTCCCAGATGATTTGCCC -3'
(R):5'- ACATTGAGCATCAGGAGAGC -3'

Sequencing Primer
(F):5'- CAGATGATTTGCCCCAAAGG -3'
(R):5'- CATTGAGCATCAGGAGAGCAGATG -3'
Posted On2014-06-30