Incidental Mutation 'R1884:Vps13b'
ID209388
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Namevacuolar protein sorting 13B
Synonyms2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 039905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R1884 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location35371160-35931229 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 35430291 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
Predicted Effect probably benign
Transcript: ENSMUST00000048646
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228338
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.3%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,114,485 M573T probably benign Het
Ank3 A G 10: 70,015,592 T1162A possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arpp21 T A 9: 112,143,527 D232V probably damaging Het
Atg2a T C 19: 6,254,384 Y1144H probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Brs3 T C X: 57,047,089 I311T probably benign Het
Cenpf C T 1: 189,646,849 V2915I probably benign Het
Cep170 G T 1: 176,774,679 T287K probably benign Het
Chst2 G A 9: 95,405,558 T245I probably damaging Het
Cnot4 C T 6: 35,078,157 V66I probably damaging Het
Cntn4 A G 6: 106,679,392 T885A probably benign Het
Col20a1 C T 2: 180,992,910 T131I possibly damaging Het
Coro7 G T 16: 4,628,819 probably benign Het
Cpne8 C A 15: 90,648,628 probably benign Het
Dbnl G A 11: 5,799,247 G356E probably benign Het
Ddx31 T A 2: 28,858,990 I266N probably damaging Het
Dnah7a A T 1: 53,541,000 I1592N probably damaging Het
Dok6 A T 18: 89,474,006 L149Q probably damaging Het
Eri2 G A 7: 119,791,123 T94I probably benign Het
Ermp1 A G 19: 29,616,679 V697A probably benign Het
Foxc1 C T 13: 31,807,665 T153M probably damaging Het
Fry A G 5: 150,403,520 I1224V probably benign Het
Fzd5 G A 1: 64,735,654 T316M probably damaging Het
Gcm1 G T 9: 78,059,579 V27L probably benign Het
Gm5773 A T 3: 93,774,041 D340V probably benign Het
Gucy2d T A 7: 98,451,608 H379Q probably benign Het
Hectd1 T A 12: 51,800,955 M392L probably benign Het
Itpr2 A C 6: 146,385,971 D452E probably benign Het
Krtap2-4 G C 11: 99,614,679 probably benign Het
Lrit1 T C 14: 37,061,753 V346A possibly damaging Het
Lrrk1 A G 7: 66,262,437 S1792P probably benign Het
Marveld2 A T 13: 100,600,621 V168E probably benign Het
Ms4a4b T A 19: 11,461,265 D149E probably damaging Het
Myom2 G A 8: 15,114,278 D1058N probably benign Het
Ncam2 C T 16: 81,437,683 P142L probably damaging Het
Nek9 A G 12: 85,332,556 L192P probably damaging Het
Nol10 T C 12: 17,368,389 probably null Het
Nrcam T C 12: 44,544,755 V194A probably damaging Het
Nudt6 A G 3: 37,412,400 V82A probably benign Het
Odf2l A T 3: 145,151,048 N492I probably damaging Het
Olfr446 T C 6: 42,927,830 S200P probably damaging Het
Olfr583 T C 7: 103,051,982 I228T probably benign Het
Pkn3 T C 2: 30,082,828 V276A probably damaging Het
Prl3b1 T G 13: 27,247,903 L137R possibly damaging Het
Rab11fip2 A G 19: 59,937,330 F10L probably damaging Het
Rab3b T A 4: 108,929,452 V133E probably damaging Het
Rnf111 A T 9: 70,476,238 S138T probably damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Runx1t1 A G 4: 13,835,767 T75A probably benign Het
Ryr2 T G 13: 11,738,356 K1693T probably damaging Het
Sdha A T 13: 74,333,136 I317N probably damaging Het
Serpina1d T A 12: 103,765,778 D274V possibly damaging Het
Setd2 T G 9: 110,556,418 probably null Het
Sh3tc2 A G 18: 62,008,575 Y1109C probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc22a2 A G 17: 12,614,826 probably benign Het
Slc35f4 A T 14: 49,313,634 W108R probably damaging Het
Slc4a1ap A G 5: 31,534,180 E440G probably damaging Het
Slc6a4 A G 11: 77,013,375 T219A probably benign Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Svil T G 18: 5,094,640 V1440G possibly damaging Het
Tas2r126 A T 6: 42,435,027 T165S probably benign Het
Tbck T C 3: 132,724,916 probably null Het
Tnxb T A 17: 34,689,565 D1520E probably benign Het
Top1mt C T 15: 75,667,901 R287H possibly damaging Het
Trdn A G 10: 33,257,095 K314E probably benign Het
Troap T A 15: 99,077,898 C233S probably benign Het
Usp28 T C 9: 49,035,947 M571T probably damaging Het
Vac14 A G 8: 110,711,687 H644R probably damaging Het
Vipr1 C T 9: 121,665,864 P327L possibly damaging Het
Vmn1r31 C T 6: 58,472,044 V279I probably damaging Het
Vmn1r69 G A 7: 10,580,751 R18W probably benign Het
Vmn2r18 G T 5: 151,575,725 Q425K probably benign Het
Vmn2r60 T C 7: 42,136,670 V299A probably damaging Het
Zfp157 A G 5: 138,444,840 D31G probably damaging Het
Zfp385c A C 11: 100,630,706 V176G probably benign Het
Zfp831 A G 2: 174,704,077 H1325R possibly damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35878825 missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35534263 missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35709240 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense probably damaging 1.00
R7232:Vps13b UTSW 15 35877557 missense probably damaging 1.00
R7307:Vps13b UTSW 15 35841545 missense probably benign
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTAGAGAGTCTGAAGCTTTC -3'
(R):5'- CAGAGCCAGCCTCAGCCT -3'

Sequencing Primer
(F):5'- GAGTCTGAAGCTTTCTATCACAGACC -3'
(R):5'- ACCTGACACTGTTACTGAGGCTATG -3'
Posted On2014-06-30