Incidental Mutation 'R1962:Shank1'
ID216973
Institutional Source Beutler Lab
Gene Symbol Shank1
Ensembl Gene ENSMUSG00000038738
Gene NameSH3 and multiple ankyrin repeat domains 1
Synonyms
MMRRC Submission 039976-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R1962 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44310253-44360572 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 44344323 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107934] [ENSMUST00000107935] [ENSMUST00000107938]
Predicted Effect probably null
Transcript: ENSMUST00000107934
SMART Domains Protein: ENSMUSP00000103567
Gene: ENSMUSG00000038738

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
PDZ 663 752 2.12e-13 SMART
Blast:PDZ 795 830 5e-11 BLAST
low complexity region 920 941 N/A INTRINSIC
low complexity region 955 982 N/A INTRINSIC
low complexity region 993 1023 N/A INTRINSIC
low complexity region 1051 1080 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
low complexity region 1179 1220 N/A INTRINSIC
low complexity region 1256 1275 N/A INTRINSIC
low complexity region 1298 1323 N/A INTRINSIC
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1369 1404 N/A INTRINSIC
low complexity region 1450 1466 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
low complexity region 1539 1555 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
low complexity region 1580 1614 N/A INTRINSIC
low complexity region 1633 1667 N/A INTRINSIC
low complexity region 1685 1720 N/A INTRINSIC
low complexity region 1735 1746 N/A INTRINSIC
low complexity region 1776 1787 N/A INTRINSIC
low complexity region 1806 1823 N/A INTRINSIC
low complexity region 1834 1852 N/A INTRINSIC
low complexity region 1893 1907 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
low complexity region 1942 1976 N/A INTRINSIC
low complexity region 1988 2004 N/A INTRINSIC
low complexity region 2009 2029 N/A INTRINSIC
low complexity region 2059 2083 N/A INTRINSIC
SAM 2092 2158 1.35e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107935
SMART Domains Protein: ENSMUSP00000103568
Gene: ENSMUSG00000038738

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 796 831 1e-10 BLAST
low complexity region 921 942 N/A INTRINSIC
low complexity region 956 983 N/A INTRINSIC
low complexity region 994 1024 N/A INTRINSIC
low complexity region 1052 1081 N/A INTRINSIC
low complexity region 1124 1139 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
low complexity region 1180 1221 N/A INTRINSIC
low complexity region 1257 1276 N/A INTRINSIC
low complexity region 1299 1324 N/A INTRINSIC
low complexity region 1349 1360 N/A INTRINSIC
low complexity region 1370 1405 N/A INTRINSIC
low complexity region 1451 1467 N/A INTRINSIC
low complexity region 1513 1533 N/A INTRINSIC
low complexity region 1540 1556 N/A INTRINSIC
low complexity region 1558 1571 N/A INTRINSIC
low complexity region 1581 1615 N/A INTRINSIC
low complexity region 1634 1668 N/A INTRINSIC
low complexity region 1686 1721 N/A INTRINSIC
low complexity region 1736 1747 N/A INTRINSIC
low complexity region 1777 1788 N/A INTRINSIC
low complexity region 1807 1824 N/A INTRINSIC
low complexity region 1835 1853 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 1926 1937 N/A INTRINSIC
low complexity region 1943 1977 N/A INTRINSIC
low complexity region 1989 2005 N/A INTRINSIC
low complexity region 2010 2030 N/A INTRINSIC
low complexity region 2060 2084 N/A INTRINSIC
SAM 2093 2159 1.35e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107938
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154776
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SHANK (SH3 domain and ankyrin repeat containing) family of proteins. Members of this family act as scaffold proteins that are required for the development and function of neuronal synapses. Deletions in this gene may be associated with autism spectrum disorder in males. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutation of this gene results in smaller pyramidal neuron dendritic spines, smaller and thinner postsynaptic density of central excitatory synapses, weaker synaptic transmission, increased anxiety-related behavior, and impaired contextual fearmemory, but enhanced spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,341,245 I354M probably damaging Het
Abca8a T C 11: 110,026,905 probably null Het
Abca8b T C 11: 109,979,898 R143G probably benign Het
Actn4 T C 7: 28,894,622 D840G probably damaging Het
Agpat5 T C 8: 18,878,010 L197P probably damaging Het
Akr1d1 T C 6: 37,536,048 V93A probably benign Het
Arap2 T C 5: 62,676,664 K820R possibly damaging Het
Armc9 T A 1: 86,207,974 C551S probably damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Brms1 C T 19: 5,045,999 R34W probably damaging Het
Cbx2 A G 11: 119,028,569 Q320R possibly damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Ccdc30 C T 4: 119,339,791 R426Q probably benign Het
Cdc42bpg T A 19: 6,306,855 V47E probably damaging Het
Cep170b C T 12: 112,738,061 S751L probably damaging Het
Cfap46 A T 7: 139,667,041 L328Q probably damaging Het
Crtc3 A G 7: 80,589,931 F558L probably damaging Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
Dchs1 A G 7: 105,764,201 Y1136H probably damaging Het
Dhrs4 T C 14: 55,487,603 V185A probably damaging Het
Dnah7b A G 1: 46,242,103 K2775E possibly damaging Het
Dst C A 1: 34,191,016 S2238R possibly damaging Het
Duox2 T C 2: 122,297,372 probably null Het
Dusp16 G T 6: 134,718,136 Y577* probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eml5 A G 12: 98,876,311 F176S probably damaging Het
Esco2 C A 14: 65,831,533 R109S probably damaging Het
Galnt7 C T 8: 57,532,714 E541K probably benign Het
Gbf1 C T 19: 46,267,219 T707I probably damaging Het
Gdf5 A G 2: 155,941,752 C427R probably damaging Het
Glyctk T C 9: 106,157,865 M1V probably null Het
Gm5478 T C 15: 101,644,395 E367G probably damaging Het
Gm9268 T C 7: 43,047,400 V620A probably benign Het
Golga7b G A 19: 42,263,329 V5I probably benign Het
Gpt2 T C 8: 85,493,135 L70P probably damaging Het
Gsdmc3 C A 15: 63,858,466 Q416H probably damaging Het
Hoxb5 A G 11: 96,304,092 E160G probably benign Het
Ift81 A T 5: 122,560,709 Y532N probably benign Het
Igf1 G A 10: 87,864,864 C66Y probably damaging Het
Igf1r T C 7: 68,207,275 V995A probably damaging Het
Ip6k1 T C 9: 108,041,088 probably null Het
Jaml T C 9: 45,104,197 I333T possibly damaging Het
Kdm4c T C 4: 74,307,016 probably benign Het
Kdm6b T C 11: 69,401,365 probably benign Het
Krt6a C T 15: 101,691,465 R404H probably damaging Het
Larp4b C A 13: 9,136,842 H69N probably benign Het
Lcat A T 8: 105,941,723 W222R probably damaging Het
Lrrc40 T A 3: 158,040,449 C54S probably benign Het
Mcpt9 T A 14: 56,027,567 H159L probably benign Het
Megf8 T C 7: 25,363,551 V2444A probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Micalcl A T 7: 112,412,844 I634L probably benign Het
Mov10 C T 3: 104,796,977 R835Q probably damaging Het
Mybpc1 A T 10: 88,548,826 L546Q probably damaging Het
Myo6 T C 9: 80,260,835 V427A probably damaging Het
Myom2 T A 8: 15,132,599 probably null Het
Mzt2 G A 16: 15,848,679 R125C probably damaging Het
Neb T A 2: 52,272,937 R2031* probably null Het
Nphp3 T C 9: 104,021,338 S447P probably benign Het
Nrp2 T A 1: 62,718,931 D25E probably benign Het
Nts A G 10: 102,485,057 L57S probably damaging Het
Nudt9 G A 5: 104,065,105 R348H probably benign Het
Olfr1299 T C 2: 111,664,889 I221T probably damaging Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Olfr211 C T 6: 116,493,764 P52S probably benign Het
Olfr401 C A 11: 74,121,824 D178E probably benign Het
Olfr976 T C 9: 39,956,683 Y84C probably benign Het
Pafah1b1 T C 11: 74,699,351 probably benign Het
Piezo2 C A 18: 63,078,840 M1291I probably damaging Het
Pik3ca T C 3: 32,443,867 F486S probably benign Het
Podnl1 C T 8: 84,127,297 H99Y probably benign Het
Prdm6 A T 18: 53,568,161 Y341F probably damaging Het
Prr5l C T 2: 101,758,509 probably null Het
Psmd4 G T 3: 95,036,701 T24N possibly damaging Het
Rbbp8nl G A 2: 180,280,874 T242M probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Scfd1 T C 12: 51,422,986 V438A probably benign Het
Scn9a A G 2: 66,484,311 C1677R probably damaging Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Sncaip C T 18: 52,871,362 H354Y probably damaging Het
St8sia2 T A 7: 73,943,309 D333V probably damaging Het
Stxbp2 C A 8: 3,642,672 R575S probably benign Het
Syt9 T A 7: 107,425,107 V69D probably damaging Het
Tanc2 A G 11: 105,798,732 N240S probably benign Het
Tcl1b1 T C 12: 105,164,468 L70S probably benign Het
Tmem44 C T 16: 30,543,401 probably null Het
Tor1b A G 2: 30,956,919 R293G probably benign Het
Trim29 T C 9: 43,311,318 V148A probably benign Het
Trmt10b C A 4: 45,314,378 Y271* probably null Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Ubqln5 T C 7: 104,128,927 D230G probably damaging Het
Ugt2b37 A G 5: 87,254,334 F146S probably damaging Het
Vmn1r160 T A 7: 22,871,402 V60E probably damaging Het
Vmn2r109 T A 17: 20,553,923 D390V probably damaging Het
Vmn2r27 C T 6: 124,223,834 R388Q possibly damaging Het
Vmn2r72 A T 7: 85,749,161 V537D probably benign Het
Vmn2r84 A G 10: 130,390,722 S416P probably damaging Het
Vmn2r98 C A 17: 19,065,333 Y138* probably null Het
Xrra1 A C 7: 99,911,020 E401A probably damaging Het
Zfp280d T A 9: 72,335,080 C688* probably null Het
Zfp3 T A 11: 70,772,128 Y304* probably null Het
Zfp407 A T 18: 84,559,336 D1217E probably benign Het
Zfp658 T C 7: 43,573,821 Y507H possibly damaging Het
Zfyve16 T C 13: 92,522,744 T220A possibly damaging Het
Zmym4 C G 4: 126,902,670 K820N possibly damaging Het
Other mutations in Shank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Shank1 APN 7 44354238 missense possibly damaging 0.89
IGL01293:Shank1 APN 7 44354236 missense possibly damaging 0.59
IGL01319:Shank1 APN 7 44353123 missense possibly damaging 0.93
IGL01347:Shank1 APN 7 44342120 missense unknown
IGL01621:Shank1 APN 7 44342465 missense unknown
IGL01621:Shank1 APN 7 44351599 missense unknown
IGL01964:Shank1 APN 7 44325678 missense unknown
IGL02309:Shank1 APN 7 44312842 missense unknown
IGL02325:Shank1 APN 7 44327080 nonsense probably null
IGL02387:Shank1 APN 7 44356937 missense possibly damaging 0.77
IGL02958:Shank1 APN 7 44354473 missense possibly damaging 0.59
R0098:Shank1 UTSW 7 44313285 missense unknown
R0098:Shank1 UTSW 7 44313285 missense unknown
R0197:Shank1 UTSW 7 44352294 missense unknown
R0326:Shank1 UTSW 7 44319170 missense unknown
R0365:Shank1 UTSW 7 44353977 missense possibly damaging 0.89
R0883:Shank1 UTSW 7 44352294 missense unknown
R1033:Shank1 UTSW 7 44356796 missense possibly damaging 0.77
R1390:Shank1 UTSW 7 44357038 missense probably damaging 1.00
R1453:Shank1 UTSW 7 44316075 missense unknown
R1594:Shank1 UTSW 7 44327223 nonsense probably null
R1713:Shank1 UTSW 7 44319737 missense unknown
R1783:Shank1 UTSW 7 44352737 missense possibly damaging 0.70
R1869:Shank1 UTSW 7 44342115 nonsense probably null
R1870:Shank1 UTSW 7 44342115 nonsense probably null
R1959:Shank1 UTSW 7 44325377 missense unknown
R2406:Shank1 UTSW 7 44356952 missense possibly damaging 0.94
R2509:Shank1 UTSW 7 44351724 missense unknown
R2509:Shank1 UTSW 7 44352123 missense unknown
R3877:Shank1 UTSW 7 44344992 missense unknown
R4041:Shank1 UTSW 7 44342162 missense unknown
R4249:Shank1 UTSW 7 44319736 missense unknown
R4303:Shank1 UTSW 7 44342474 missense unknown
R4431:Shank1 UTSW 7 44319652 nonsense probably null
R4525:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4527:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4642:Shank1 UTSW 7 44313141 missense unknown
R4722:Shank1 UTSW 7 44313214 nonsense probably null
R4805:Shank1 UTSW 7 44343711 missense unknown
R4874:Shank1 UTSW 7 44316073 missense unknown
R4904:Shank1 UTSW 7 44334040 intron probably benign
R4939:Shank1 UTSW 7 44326162 missense unknown
R5394:Shank1 UTSW 7 44352651 missense possibly damaging 0.85
R5410:Shank1 UTSW 7 44351822 missense unknown
R5556:Shank1 UTSW 7 44344315 intron probably benign
R5620:Shank1 UTSW 7 44312736 missense unknown
R5656:Shank1 UTSW 7 44352886 missense probably benign 0.33
R5688:Shank1 UTSW 7 44354487 missense possibly damaging 0.77
R5740:Shank1 UTSW 7 44353740 missense possibly damaging 0.89
R5801:Shank1 UTSW 7 44356816 missense possibly damaging 0.77
R6179:Shank1 UTSW 7 44357206 missense possibly damaging 0.58
R6186:Shank1 UTSW 7 44352566 missense probably benign 0.18
R6245:Shank1 UTSW 7 44352253 missense unknown
R6500:Shank1 UTSW 7 44327221 missense unknown
R6602:Shank1 UTSW 7 44352336 missense probably benign 0.03
R6655:Shank1 UTSW 7 44327220 missense unknown
R6709:Shank1 UTSW 7 44354176 missense probably benign 0.43
R6734:Shank1 UTSW 7 44353686 missense probably benign 0.01
R6881:Shank1 UTSW 7 44351793 missense unknown
R6902:Shank1 UTSW 7 44356815 missense probably benign 0.39
R6975:Shank1 UTSW 7 44313106 splice site probably null
R6985:Shank1 UTSW 7 44344913 missense unknown
R7072:Shank1 UTSW 7 44344946 missense unknown
R7116:Shank1 UTSW 7 44327161 missense unknown
R7117:Shank1 UTSW 7 44327161 missense unknown
R7199:Shank1 UTSW 7 44353140 missense possibly damaging 0.86
R7249:Shank1 UTSW 7 44327161 missense unknown
R7252:Shank1 UTSW 7 44327161 missense unknown
R7653:Shank1 UTSW 7 44319669 missense unknown
X0019:Shank1 UTSW 7 44356928 missense probably damaging 1.00
X0065:Shank1 UTSW 7 44351929 missense unknown
Z1088:Shank1 UTSW 7 44352166 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCCTTGTAGGCAGATTCTC -3'
(R):5'- CGTATTCTGTGGGCAAAGGG -3'

Sequencing Primer
(F):5'- AGGCAGATTCTCATGACCTGG -3'
(R):5'- GGAGGGATGAAGCTCAAGGGTAC -3'
Posted On2014-08-01