Incidental Mutation 'R1987:Ubqlnl'
ID222670
Institutional Source Beutler Lab
Gene Symbol Ubqlnl
Ensembl Gene ENSMUSG00000051437
Gene Nameubiquilin-like
SynonymsLOC244179, 4922504M18Rik
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1987 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104148259-104150556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104148485 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 602 (Y602H)
Ref Sequence ENSEMBL: ENSMUSP00000056365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121]
PDB Structure
Solution Structure of RSGI RUH-056, a UBA domain from mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000051137
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059121
AA Change: Y602H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437
AA Change: Y602H

DomainStartEndE-ValueType
UBQ 31 101 5.13e-16 SMART
Blast:STI1 199 237 8e-11 BLAST
low complexity region 339 350 N/A INTRINSIC
low complexity region 402 419 N/A INTRINSIC
PDB:2DNA|A 561 610 3e-26 PDB
Blast:UBA 568 604 1e-10 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal in terms of growth and behavior. Adult males are fertile and show no apparent defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 Q433L probably damaging Het
4932438A13Rik T A 3: 36,953,985 probably null Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fsd2 A G 7: 81,559,659 V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 M767T probably benign Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prrt2 A G 7: 127,018,730 V59A probably benign Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Setd1b A T 5: 123,147,706 T272S unknown Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in Ubqlnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ubqlnl APN 7 104149165 missense probably benign
IGL01592:Ubqlnl APN 7 104150289 unclassified probably benign
IGL01972:Ubqlnl APN 7 104149697 missense probably benign 0.00
IGL02266:Ubqlnl APN 7 104149547 nonsense probably null
IGL02447:Ubqlnl APN 7 104148649 missense probably damaging 1.00
IGL03232:Ubqlnl APN 7 104148629 missense possibly damaging 0.71
FR4737:Ubqlnl UTSW 7 104149835 unclassified probably benign
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0077:Ubqlnl UTSW 7 104150047 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0517:Ubqlnl UTSW 7 104148638 missense probably damaging 1.00
R1129:Ubqlnl UTSW 7 104149650 missense probably damaging 0.98
R1885:Ubqlnl UTSW 7 104150065 missense possibly damaging 0.88
R2151:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2152:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2153:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R3712:Ubqlnl UTSW 7 104149138 missense probably benign 0.03
R3914:Ubqlnl UTSW 7 104149606 missense probably benign
R4367:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4404:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4405:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4406:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4407:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4449:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4458:Ubqlnl UTSW 7 104149189 missense probably benign 0.01
R4508:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4516:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4517:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4518:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4522:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4523:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4524:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4529:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4531:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4738:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4739:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4740:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R5339:Ubqlnl UTSW 7 104149765 missense probably benign 0.00
R5357:Ubqlnl UTSW 7 104148931 missense probably damaging 1.00
R5386:Ubqlnl UTSW 7 104149217 missense probably benign 0.01
R5542:Ubqlnl UTSW 7 104149697 nonsense probably null
R5588:Ubqlnl UTSW 7 104149132 missense probably damaging 1.00
R6058:Ubqlnl UTSW 7 104148752 missense probably benign
R6084:Ubqlnl UTSW 7 104148698 missense probably benign 0.01
R6207:Ubqlnl UTSW 7 104148708 missense possibly damaging 0.73
R6794:Ubqlnl UTSW 7 104148785 missense probably benign 0.34
Z1088:Ubqlnl UTSW 7 104149993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTTCCAGCCATGACCAG -3'
(R):5'- GAGCCTCAGTGTCCTGAAAG -3'

Sequencing Primer
(F):5'- GCCATGACCAGTGAGCTAGTATTC -3'
(R):5'- TCAGTGTCCTGAAAGCTGCC -3'
Posted On2014-08-25