Incidental Mutation 'R2019:Abi3bp'
ID223703
Institutional Source Beutler Lab
Gene Symbol Abi3bp
Ensembl Gene ENSMUSG00000035258
Gene NameABI gene family, member 3 (NESH) binding protein
SynonymsD930038M13Rik, eratin, TARSH, 5033411B22Rik
MMRRC Submission 040028-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2019 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location56477878-56690135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56677796 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 918 (T918A)
Ref Sequence ENSEMBL: ENSMUSP00000156180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]
Predicted Effect probably damaging
Transcript: ENSMUST00000048471
AA Change: T998A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: T998A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 734 747 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
FN3 941 1024 6.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096012
AA Change: T898A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: T898A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 651 664 N/A INTRINSIC
FN3 841 924 6.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096013
AA Change: T934A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: T934A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
FN3 877 960 6.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171000
AA Change: T728A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258
AA Change: T728A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 464 477 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
FN3 671 754 6.29e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231781
AA Change: T1456A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000231832
AA Change: T703A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231870
AA Change: T918A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
Abcc9 G A 6: 142,675,434 L527F probably damaging Het
Acpp C T 9: 104,324,702 G81R probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amz1 G T 5: 140,751,964 M326I probably benign Het
Ankrd36 A G 11: 5,689,140 I1351V probably benign Het
Art2b T C 7: 101,579,987 D235G probably benign Het
Ccdc141 A C 2: 77,011,565 I1507M probably damaging Het
Dck A G 5: 88,774,084 Y135C probably damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnttip2 T C 3: 122,280,744 V610A possibly damaging Het
Efhb A G 17: 53,401,477 S722P probably damaging Het
Emx2 A G 19: 59,459,339 S42G probably benign Het
Ermard C T 17: 15,053,265 R371C probably damaging Het
Fat1 T G 8: 45,023,746 I1943S probably damaging Het
Fignl1 T C 11: 11,802,054 K334E probably damaging Het
Fmn1 A C 2: 113,364,480 K175T unknown Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gpalpp1 A T 14: 76,110,691 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Ifngr1 A T 10: 19,592,113 M10L probably damaging Het
Irx5 T G 8: 92,358,364 Y61D probably damaging Het
Itgax A G 7: 128,148,526 H1038R probably benign Het
Jag1 C T 2: 137,084,679 E982K probably benign Het
Klhdc9 T C 1: 171,358,941 D309G probably damaging Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Lrpprc A T 17: 84,752,331 L685Q possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mgat5b A G 11: 116,947,348 Y271C probably benign Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myo16 T C 8: 10,376,260 L339P probably benign Het
Neb G T 2: 52,232,276 Y580* probably null Het
Npat A G 9: 53,562,491 K528E probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr350 A T 2: 36,850,406 Y120F possibly damaging Het
Parp8 G A 13: 116,868,432 probably benign Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Phospho1 G A 11: 95,831,106 V201M probably damaging Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Pitpnm1 T C 19: 4,113,641 S1209P probably damaging Het
Pkd1 T A 17: 24,568,684 C20* probably null Het
Prdm5 C A 6: 65,831,356 N95K probably damaging Het
Prkx T C X: 77,765,404 D270G probably damaging Het
Ptgis A G 2: 167,208,279 V310A probably damaging Het
Ptgis G A 2: 167,214,810 Q286* probably null Het
Rpf1 T A 3: 146,521,221 N59I probably damaging Het
Rpl3l A C 17: 24,735,516 probably benign Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Sla T C 15: 66,782,555 Y278C probably damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Tada2b T C 5: 36,483,906 Y51C probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Tgfbrap1 A G 1: 43,054,517 probably null Het
Tmem116 A G 5: 121,489,254 I151M possibly damaging Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Txnrd1 G A 10: 82,877,373 V90I probably benign Het
Unc79 G A 12: 103,171,571 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Wdr59 A G 8: 111,466,793 Y666H probably damaging Het
Wdr95 A G 5: 149,574,148 probably benign Het
Other mutations in Abi3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Abi3bp APN 16 56602805 missense probably null 0.99
IGL01580:Abi3bp APN 16 56675210 missense probably damaging 1.00
IGL01633:Abi3bp APN 16 56677800 missense probably damaging 1.00
IGL01783:Abi3bp APN 16 56532969 critical splice donor site probably null
IGL01866:Abi3bp APN 16 56671973 missense probably benign 0.19
IGL02022:Abi3bp APN 16 56592636 missense probably damaging 1.00
IGL02086:Abi3bp APN 16 56642567 splice site probably benign
IGL02122:Abi3bp APN 16 56687128 splice site probably benign
IGL02155:Abi3bp APN 16 56587964 missense probably damaging 0.99
IGL02351:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02358:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02418:Abi3bp APN 16 56604116 splice site probably benign
IGL02559:Abi3bp APN 16 56687070 nonsense probably null
IGL02617:Abi3bp APN 16 56574444 nonsense probably null
IGL02810:Abi3bp APN 16 56677775 missense probably damaging 1.00
IGL03057:Abi3bp APN 16 56668391 missense possibly damaging 0.95
IGL03174:Abi3bp APN 16 56614747 missense possibly damaging 0.64
R0389:Abi3bp UTSW 16 56671307 missense possibly damaging 0.79
R0485:Abi3bp UTSW 16 56604012 intron probably null
R0557:Abi3bp UTSW 16 56668387 missense probably damaging 0.97
R0616:Abi3bp UTSW 16 56654070 missense probably damaging 0.99
R0685:Abi3bp UTSW 16 56532953 missense possibly damaging 0.90
R0783:Abi3bp UTSW 16 56595238 critical splice acceptor site probably null
R0828:Abi3bp UTSW 16 56677830 missense probably damaging 1.00
R0841:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1078:Abi3bp UTSW 16 56654081 critical splice donor site probably null
R1101:Abi3bp UTSW 16 56606158 missense probably damaging 1.00
R1116:Abi3bp UTSW 16 56686429 splice site probably benign
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1317:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1384:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1460:Abi3bp UTSW 16 56562417 missense probably damaging 0.99
R1730:Abi3bp UTSW 16 56668279 missense possibly damaging 0.62
R1761:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1830:Abi3bp UTSW 16 56587985 missense probably damaging 1.00
R1873:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1875:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1996:Abi3bp UTSW 16 56671357 missense possibly damaging 0.61
R2018:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2035:Abi3bp UTSW 16 56660218 missense probably benign 0.21
R2118:Abi3bp UTSW 16 56477864 unclassified probably benign
R2202:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R2202:Abi3bp UTSW 16 56650725 nonsense probably null
R2203:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R3030:Abi3bp UTSW 16 56657319 missense possibly damaging 0.79
R3952:Abi3bp UTSW 16 56604038 missense possibly damaging 0.88
R4176:Abi3bp UTSW 16 56652200 missense probably damaging 0.96
R4296:Abi3bp UTSW 16 56668310 missense probably benign 0.05
R4301:Abi3bp UTSW 16 56556903 missense probably damaging 1.00
R4354:Abi3bp UTSW 16 56532951 missense probably benign 0.05
R4417:Abi3bp UTSW 16 56654035 missense probably damaging 1.00
R4716:Abi3bp UTSW 16 56650725 nonsense probably null
R4808:Abi3bp UTSW 16 56594516 missense probably damaging 0.96
R4814:Abi3bp UTSW 16 56650753 missense probably benign 0.06
R5016:Abi3bp UTSW 16 56671268 missense probably damaging 0.97
R5290:Abi3bp UTSW 16 56642475 splice site probably null
R5891:Abi3bp UTSW 16 56606133 missense probably damaging 1.00
R5897:Abi3bp UTSW 16 56604669 missense possibly damaging 0.53
R6146:Abi3bp UTSW 16 56671265 missense probably damaging 0.99
R6267:Abi3bp UTSW 16 56594497 missense probably damaging 0.97
R6905:Abi3bp UTSW 16 56574517 missense probably damaging 1.00
R6908:Abi3bp UTSW 16 56657305 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCAGCCAATCTGTCATTGC -3'
(R):5'- AGTTAATTTCTGCCGTGCATACTC -3'

Sequencing Primer
(F):5'- GCAGCCAATCTGTCATTGCTATGAG -3'
(R):5'- GCCGTGCATACTCCATTTTTACTAG -3'
Posted On2014-08-25