Incidental Mutation 'R0616:Abi3bp'
ID58360
Institutional Source Beutler Lab
Gene Symbol Abi3bp
Ensembl Gene ENSMUSG00000035258
Gene NameABI gene family, member 3 (NESH) binding protein
SynonymsD930038M13Rik, eratin, TARSH, 5033411B22Rik
MMRRC Submission 038805-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0616 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location56477878-56690135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56654070 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 723 (T723S)
Ref Sequence ENSEMBL: ENSMUSP00000036257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]
Predicted Effect probably damaging
Transcript: ENSMUST00000048471
AA Change: T723S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: T723S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 734 747 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
FN3 941 1024 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096012
AA Change: T623S

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: T623S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 651 664 N/A INTRINSIC
FN3 841 924 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096013
AA Change: T659S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: T659S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
FN3 877 960 6.29e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171000
AA Change: T453S

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258
AA Change: T453S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 464 477 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
FN3 671 754 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231781
AA Change: T1181S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000231832
AA Change: T428S

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231870
AA Change: T643S

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,773,656 T198K possibly damaging Het
Abca12 G T 1: 71,302,671 Q1044K probably damaging Het
Ackr3 G A 1: 90,214,469 V217I probably benign Het
Acnat2 A G 4: 49,380,269 S370P probably damaging Het
Arap1 A G 7: 101,401,650 R1152G possibly damaging Het
Arhgap15 G A 2: 44,116,717 probably null Het
Arhgap5 C T 12: 52,517,065 T273I possibly damaging Het
BC017158 A T 7: 128,272,631 probably null Het
C1s2 T C 6: 124,628,764 E332G probably damaging Het
Camp G A 9: 109,848,639 R88W probably benign Het
Cdkl2 A G 5: 92,009,004 M564T probably benign Het
Ceacam20 A G 7: 19,970,396 H124R probably benign Het
Cep19 C T 16: 32,104,011 R32C probably damaging Het
Cep295 G A 9: 15,332,322 Q1565* probably null Het
Chd3 T C 11: 69,345,487 E1932G probably damaging Het
Cnr2 G T 4: 135,917,562 W317L probably benign Het
Cntnap5a C T 1: 116,580,549 H1264Y possibly damaging Het
Depdc7 T A 2: 104,727,305 N200I probably benign Het
Dock4 T C 12: 40,704,415 S468P probably benign Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Fam126a T C 5: 23,986,772 T44A probably damaging Het
Fam217a C A 13: 34,913,683 S55I probably benign Het
Fam92a G A 4: 12,168,234 R210* probably null Het
Farp1 G A 14: 121,277,022 R921H probably damaging Het
Fat4 A G 3: 38,942,870 D1746G probably damaging Het
Fbxw5 T C 2: 25,502,505 F100L probably damaging Het
Gli3 C A 13: 15,662,406 T458K possibly damaging Het
Gm4841 T C 18: 60,270,937 Y28C probably benign Het
Gprc5d T C 6: 135,116,432 E159G probably benign Het
Grm4 A T 17: 27,434,564 I757N probably damaging Het
Hagh A G 17: 24,857,577 Y94C probably damaging Het
Itpkb T C 1: 180,421,736 I892T probably damaging Het
Kcmf1 T C 6: 72,850,484 I58V probably benign Het
Khdrbs2 A G 1: 32,467,775 I167V possibly damaging Het
Kmt2c A G 5: 25,299,252 I275T probably benign Het
Lingo4 A G 3: 94,403,081 K442R probably benign Het
Mak T C 13: 41,042,185 N382D probably benign Het
Maob G A X: 16,710,163 T480I possibly damaging Het
Mcoln1 A G 8: 3,515,025 E573G probably benign Het
Ms4a6b G A 19: 11,526,898 probably null Het
Muc5ac A G 7: 141,796,244 M576V probably benign Het
Nme8 T A 13: 19,690,859 D126V probably benign Het
Npy2r T A 3: 82,541,363 D35V possibly damaging Het
Nrxn1 T C 17: 90,362,857 D193G probably damaging Het
Olfr1257 T A 2: 89,881,591 V255E probably benign Het
Olfr130 A C 17: 38,067,240 E23A probably damaging Het
Olfr1391 T C 11: 49,327,756 L115P probably damaging Het
Olfr1537 G A 9: 39,237,650 T258M probably benign Het
Olfr214 A G 6: 116,556,928 I168V probably benign Het
Olfr548-ps1 T A 7: 102,542,554 M206K possibly damaging Het
Olfr895 G T 9: 38,269,334 V266L probably benign Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Olfr984 A T 9: 40,100,987 F168I probably damaging Het
Pabpc2 A T 18: 39,773,739 H19L possibly damaging Het
Pcdhb9 A T 18: 37,401,975 K341* probably null Het
Pde4dip T C 3: 97,747,533 I859M probably benign Het
Pfkfb2 T C 1: 130,706,422 probably null Het
Pigg C T 5: 108,314,085 T94M probably damaging Het
Pik3c2b T C 1: 133,100,831 F1353L probably damaging Het
Prg4 T C 1: 150,460,711 D87G probably damaging Het
Prkdc A T 16: 15,690,407 D974V probably damaging Het
Prmt3 A G 7: 49,787,328 Y217C probably damaging Het
Proser1 A G 3: 53,474,697 T192A probably damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Rb1cc1 A G 1: 6,244,262 K386R possibly damaging Het
Rcn2 A G 9: 56,056,250 D221G probably benign Het
Rhbdl3 T G 11: 80,331,861 H245Q probably damaging Het
Ribc1 T C X: 152,005,791 E204G probably damaging Het
Rpap1 G A 2: 119,778,120 L254F probably damaging Het
Rrp12 A G 19: 41,892,549 F148L possibly damaging Het
Setdb1 A T 3: 95,341,798 I333K probably damaging Het
Simc1 A G 13: 54,547,032 I1210V probably benign Het
Smchd1 T A 17: 71,379,574 D1379V probably benign Het
Snap29 A T 16: 17,422,506 K159* probably null Het
Spdye4c A T 2: 128,594,212 K176M possibly damaging Het
Stk31 T A 6: 49,423,485 W415R probably damaging Het
Supt6 C T 11: 78,209,495 R1497Q probably damaging Het
Tenm3 A G 8: 48,276,156 I1605T possibly damaging Het
Ttn T C 2: 76,846,623 probably null Het
Ttn A G 2: 76,897,667 probably benign Het
Ucp3 A T 7: 100,480,161 T68S probably benign Het
Ugt2b36 T C 5: 87,089,477 N316D probably benign Het
Usp4 T G 9: 108,366,804 S247A probably benign Het
Utp20 A T 10: 88,770,751 V1653D probably benign Het
Vmn1r183 A G 7: 24,054,825 I18V probably benign Het
Vmn1r237 A G 17: 21,314,623 M203V probably damaging Het
Vmn1r61 A T 7: 5,610,999 F105L possibly damaging Het
Zfp462 T C 4: 55,011,951 C158R probably damaging Het
Zfyve16 C G 13: 92,521,129 R758P probably damaging Het
Other mutations in Abi3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Abi3bp APN 16 56602805 missense probably null 0.99
IGL01580:Abi3bp APN 16 56675210 missense probably damaging 1.00
IGL01633:Abi3bp APN 16 56677800 missense probably damaging 1.00
IGL01783:Abi3bp APN 16 56532969 critical splice donor site probably null
IGL01866:Abi3bp APN 16 56671973 missense probably benign 0.19
IGL02022:Abi3bp APN 16 56592636 missense probably damaging 1.00
IGL02086:Abi3bp APN 16 56642567 splice site probably benign
IGL02122:Abi3bp APN 16 56687128 splice site probably benign
IGL02155:Abi3bp APN 16 56587964 missense probably damaging 0.99
IGL02351:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02358:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02418:Abi3bp APN 16 56604116 splice site probably benign
IGL02559:Abi3bp APN 16 56687070 nonsense probably null
IGL02617:Abi3bp APN 16 56574444 nonsense probably null
IGL02810:Abi3bp APN 16 56677775 missense probably damaging 1.00
IGL03057:Abi3bp APN 16 56668391 missense possibly damaging 0.95
IGL03174:Abi3bp APN 16 56614747 missense possibly damaging 0.64
R0389:Abi3bp UTSW 16 56671307 missense possibly damaging 0.79
R0485:Abi3bp UTSW 16 56604012 intron probably null
R0557:Abi3bp UTSW 16 56668387 missense probably damaging 0.97
R0685:Abi3bp UTSW 16 56532953 missense possibly damaging 0.90
R0783:Abi3bp UTSW 16 56595238 critical splice acceptor site probably null
R0828:Abi3bp UTSW 16 56677830 missense probably damaging 1.00
R0841:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1078:Abi3bp UTSW 16 56654081 critical splice donor site probably null
R1101:Abi3bp UTSW 16 56606158 missense probably damaging 1.00
R1116:Abi3bp UTSW 16 56686429 splice site probably benign
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1317:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1384:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1460:Abi3bp UTSW 16 56562417 missense probably damaging 0.99
R1730:Abi3bp UTSW 16 56668279 missense possibly damaging 0.62
R1761:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1830:Abi3bp UTSW 16 56587985 missense probably damaging 1.00
R1873:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1875:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1996:Abi3bp UTSW 16 56671357 missense possibly damaging 0.61
R2018:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2019:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2035:Abi3bp UTSW 16 56660218 missense probably benign 0.21
R2118:Abi3bp UTSW 16 56477864 unclassified probably benign
R2202:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R2202:Abi3bp UTSW 16 56650725 nonsense probably null
R2203:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R3030:Abi3bp UTSW 16 56657319 missense possibly damaging 0.79
R3952:Abi3bp UTSW 16 56604038 missense possibly damaging 0.88
R4176:Abi3bp UTSW 16 56652200 missense probably damaging 0.96
R4296:Abi3bp UTSW 16 56668310 missense probably benign 0.05
R4301:Abi3bp UTSW 16 56556903 missense probably damaging 1.00
R4354:Abi3bp UTSW 16 56532951 missense probably benign 0.05
R4417:Abi3bp UTSW 16 56654035 missense probably damaging 1.00
R4716:Abi3bp UTSW 16 56650725 nonsense probably null
R4808:Abi3bp UTSW 16 56594516 missense probably damaging 0.96
R4814:Abi3bp UTSW 16 56650753 missense probably benign 0.06
R5016:Abi3bp UTSW 16 56671268 missense probably damaging 0.97
R5290:Abi3bp UTSW 16 56642475 splice site probably null
R5891:Abi3bp UTSW 16 56606133 missense probably damaging 1.00
R5897:Abi3bp UTSW 16 56604669 missense possibly damaging 0.53
R6146:Abi3bp UTSW 16 56671265 missense probably damaging 0.99
R6267:Abi3bp UTSW 16 56594497 missense probably damaging 0.97
R6905:Abi3bp UTSW 16 56574517 missense probably damaging 1.00
R6908:Abi3bp UTSW 16 56657305 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATAAAACAGCTACCTTGGCCCCTTTC -3'
(R):5'- ATGGCAGTCAATTTGCCCGAGACC -3'

Sequencing Primer
(F):5'- AAAGATGCCTTGGAAGTCCTTG -3'
(R):5'- TGCCCGAGACCCTTCATC -3'
Posted On2013-07-11