Incidental Mutation 'R2078:Olfr1444'
ID229307
Institutional Source Beutler Lab
Gene Symbol Olfr1444
Ensembl Gene ENSMUSG00000046272
Gene Nameolfactory receptor 1444
SynonymsMOR202-4, GA_x6K02T2RE5P-3191201-3192160
MMRRC Submission 040083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R2078 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12857283-12863440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12862387 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 204 (V204E)
Ref Sequence ENSEMBL: ENSMUSP00000150212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059675] [ENSMUST00000213606]
Predicted Effect probably benign
Transcript: ENSMUST00000059675
AA Change: V204E

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062460
Gene: ENSMUSG00000046272
AA Change: V204E

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.6e-54 PFAM
Pfam:7tm_1 42 291 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213606
AA Change: V204E

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C A 1: 75,172,136 G55C probably damaging Het
Acss3 T C 10: 106,967,041 T448A possibly damaging Het
Atxn7 A G 14: 14,052,975 N138D probably damaging Het
Cacna2d4 A T 6: 119,338,116 D869V probably benign Het
Cps1 T G 1: 67,157,806 Y339D probably damaging Het
Cps1 T C 1: 67,195,265 I937T possibly damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dusp6 T C 10: 99,263,824 Y45H probably damaging Het
Ebag9 A G 15: 44,636,804 N157S probably damaging Het
Exoc4 A G 6: 33,910,587 D770G probably benign Het
Ezr A G 17: 6,782,642 M1T probably null Het
Fat4 A G 3: 38,889,673 N905S probably damaging Het
Fcrlb C G 1: 170,908,081 R208P probably damaging Het
Flnb T C 14: 7,927,466 V1892A probably damaging Het
Gas2 G A 7: 51,897,325 V75M probably benign Het
Gda T A 19: 21,400,672 D267V probably damaging Het
Gper1 A T 5: 139,426,133 I78F probably benign Het
Hectd1 A C 12: 51,748,542 I2368S probably damaging Het
Katna1 C T 10: 7,743,569 P114S probably benign Het
Lce3c G A 3: 92,945,451 S73N unknown Het
Lrfn3 A T 7: 30,360,454 D115E possibly damaging Het
Lrrc47 C A 4: 154,019,431 T505K probably damaging Het
Mertk C T 2: 128,794,458 T784I probably damaging Het
Mettl21e T A 1: 44,206,502 I195F possibly damaging Het
Mff T C 1: 82,741,921 S207P probably damaging Het
Mtmr6 A G 14: 60,291,987 probably null Het
Myh9 T C 15: 77,763,912 K1788R probably benign Het
Narf A G 11: 121,245,394 T199A probably benign Het
Neurod6 A G 6: 55,678,969 S228P probably benign Het
Notch4 A T 17: 34,568,715 probably null Het
Nyap2 T C 1: 81,191,981 L151P probably damaging Het
P2ry1 A G 3: 61,003,697 I86V probably damaging Het
Pafah1b2 G T 9: 45,968,829 D183E probably damaging Het
Phldb1 T C 9: 44,707,979 E179G probably damaging Het
Piezo2 T C 18: 63,117,720 E436G probably damaging Het
Pkhd1l1 A G 15: 44,527,767 I1514V probably benign Het
Plch1 A G 3: 63,701,943 S948P probably benign Het
Rfc5 A G 5: 117,380,803 V296A probably benign Het
Rnf150 A T 8: 83,003,605 I255F probably damaging Het
Rsbn1 A G 3: 103,961,523 D626G probably damaging Het
Sfswap A G 5: 129,516,107 D346G possibly damaging Het
Slc38a11 A T 2: 65,330,384 F289I possibly damaging Het
Terf2ip A G 8: 112,015,403 N243S probably benign Het
Tmed5 A T 5: 108,124,605 V209E probably damaging Het
Tmem63b A G 17: 45,663,536 S603P possibly damaging Het
Tomm20 T C 8: 126,937,072 M121V possibly damaging Het
Tspan33 G A 6: 29,709,971 V45I probably benign Het
Usp17la A T 7: 104,859,393 M1L probably benign Het
Vsig8 C A 1: 172,563,289 D301E probably benign Het
Vwa8 T A 14: 78,908,157 H91Q probably damaging Het
Other mutations in Olfr1444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Olfr1444 APN 19 12861867 missense probably benign 0.00
IGL01963:Olfr1444 APN 19 12862382 missense probably benign 0.00
IGL02030:Olfr1444 APN 19 12862435 missense probably benign 0.00
IGL02178:Olfr1444 APN 19 12862543 missense possibly damaging 0.49
IGL02641:Olfr1444 APN 19 12862202 nonsense probably null
R0311:Olfr1444 UTSW 19 12861869 missense probably benign 0.01
R0543:Olfr1444 UTSW 19 12861888 missense probably benign 0.00
R0815:Olfr1444 UTSW 19 12862644 missense probably benign 0.00
R2034:Olfr1444 UTSW 19 12861787 missense possibly damaging 0.82
R2431:Olfr1444 UTSW 19 12862606 missense probably damaging 1.00
R3032:Olfr1444 UTSW 19 12861918 missense probably benign 0.00
R3932:Olfr1444 UTSW 19 12862630 missense possibly damaging 0.95
R4498:Olfr1444 UTSW 19 12862669 missense probably damaging 1.00
R4654:Olfr1444 UTSW 19 12862232 nonsense probably null
R4708:Olfr1444 UTSW 19 12861897 missense probably benign 0.00
R4823:Olfr1444 UTSW 19 12861816 missense probably benign 0.04
R4938:Olfr1444 UTSW 19 12862552 missense probably damaging 1.00
R4980:Olfr1444 UTSW 19 12862020 missense probably benign
R5580:Olfr1444 UTSW 19 12861804 missense possibly damaging 0.59
R5622:Olfr1444 UTSW 19 12862299 missense probably benign 0.08
R5671:Olfr1444 UTSW 19 12861807 missense probably benign 0.02
R6149:Olfr1444 UTSW 19 12862359 missense probably benign 0.02
R6683:Olfr1444 UTSW 19 12862650 missense probably damaging 0.98
R7389:Olfr1444 UTSW 19 12862617 missense probably benign 0.04
R7392:Olfr1444 UTSW 19 12862587 missense probably benign 0.18
R7461:Olfr1444 UTSW 19 12861777 start codon destroyed probably benign 0.00
Z1088:Olfr1444 UTSW 19 12862284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCTCTTCATTACACCAC -3'
(R):5'- ACTGGGCTGCAAGTACATGAAG -3'

Sequencing Primer
(F):5'- CACCATGACAACTGGTGTGTGTAC -3'
(R):5'- GCAAGTACATGAAGATAATTGTGCC -3'
Posted On2014-09-17