Incidental Mutation 'R2080:Tipin'
ID229426
Institutional Source Beutler Lab
Gene Symbol Tipin
Ensembl Gene ENSMUSG00000032397
Gene Nametimeless interacting protein
Synonyms
MMRRC Submission 040085-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R2080 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location64281581-64305424 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 64290376 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 69 (L69*)
Ref Sequence ENSEMBL: ENSMUSP00000149833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034964] [ENSMUST00000213165] [ENSMUST00000213289] [ENSMUST00000215031] [ENSMUST00000216594]
Predicted Effect probably null
Transcript: ENSMUST00000034964
AA Change: L69*
SMART Domains Protein: ENSMUSP00000034964
Gene: ENSMUSG00000032397
AA Change: L69*

DomainStartEndE-ValueType
low complexity region 19 43 N/A INTRINSIC
Pfam:Swi3 63 143 2.8e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213165
AA Change: L69*
Predicted Effect probably null
Transcript: ENSMUST00000213289
AA Change: L69*
Predicted Effect probably null
Transcript: ENSMUST00000215031
AA Change: L69*
Predicted Effect probably null
Transcript: ENSMUST00000216594
AA Change: L69*
Meta Mutation Damage Score 0.544 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the replisome complex, a group of proteins that support DNA replication. It binds TIM and aids in protecting cells against DNA damage and stress. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,971,933 D183V probably damaging Het
Ambra1 T A 2: 91,885,719 D858E probably damaging Het
Amdhd2 T C 17: 24,156,604 T370A probably benign Het
Amy1 A G 3: 113,558,094 W449R probably benign Het
Aox3 A T 1: 58,186,280 I1179F probably benign Het
Atp10a C A 7: 58,824,327 Q1121K probably damaging Het
Btaf1 C T 19: 36,951,148 A123V probably benign Het
Car6 T C 4: 150,198,141 K16E probably benign Het
Cgnl1 C T 9: 71,656,096 D779N probably benign Het
Cyp2a4 G A 7: 26,308,537 R123Q possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
D5Ertd579e T A 5: 36,616,206 T282S probably benign Het
Dsel T C 1: 111,859,962 T948A probably benign Het
Ednrb A T 14: 103,843,100 I126N probably damaging Het
Egln1 A G 8: 124,948,306 M250T probably benign Het
Epb41l3 A T 17: 69,253,468 I337L possibly damaging Het
Epg5 T C 18: 77,948,745 I219T probably benign Het
Gm13030 T C 4: 138,873,419 probably benign Het
Gm1527 T A 3: 28,926,661 C637S probably benign Het
Hist1h1a A G 13: 23,763,949 N78S possibly damaging Het
Insrr T C 3: 87,814,291 I1168T possibly damaging Het
Ireb2 T C 9: 54,896,552 V509A possibly damaging Het
Kmt2c T C 5: 25,354,717 D981G probably damaging Het
Ktn1 A G 14: 47,725,960 E1164G probably damaging Het
L3hypdh A T 12: 72,079,527 V213E probably damaging Het
Masp1 T G 16: 23,491,959 D241A probably damaging Het
Mfsd13b A G 7: 120,991,824 I1V probably null Het
Muc5b T C 7: 141,869,754 V4531A probably benign Het
Myh2 A T 11: 67,174,941 probably null Het
Naip5 A G 13: 100,221,533 L1065P probably damaging Het
Necab1 T C 4: 15,140,219 probably benign Het
Nemf A G 12: 69,353,786 probably benign Het
Nfil3 A T 13: 52,968,033 D278E possibly damaging Het
Nup98 T C 7: 102,180,424 N393S probably damaging Het
Ogdh T A 11: 6,349,393 M753K probably benign Het
Olfr11 A T 13: 21,639,436 V29E probably damaging Het
Olfr1297 C T 2: 111,621,739 V112M probably benign Het
Olfr273 T C 4: 52,855,568 Y315C probably benign Het
Olfr561 T C 7: 102,775,243 F240L probably benign Het
Olfr901 T A 9: 38,431,082 S267T probably benign Het
Pkd2 A G 5: 104,477,123 K262E probably benign Het
Plce1 C T 19: 38,727,013 probably benign Het
Ppm1f T A 16: 16,923,880 M406K possibly damaging Het
Ptgs1 C T 2: 36,242,847 Q286* probably null Het
Scube2 T C 7: 109,808,505 T743A possibly damaging Het
Tlk1 T A 2: 70,738,445 K404N probably damaging Het
Tmem59 C A 4: 107,178,774 L16I probably damaging Het
Utrn T C 10: 12,737,082 E426G probably benign Het
Xdh A T 17: 73,909,325 S709T probably damaging Het
Yjefn3 T C 8: 69,889,487 N28D probably damaging Het
Zfp598 A C 17: 24,679,667 D480A probably damaging Het
Other mutations in Tipin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Tipin APN 9 64304408 missense probably benign
IGL02164:Tipin APN 9 64294349 missense probably damaging 0.99
IGL02431:Tipin APN 9 64301185 missense probably benign 0.42
IGL03355:Tipin APN 9 64288124 missense probably benign 0.29
R0410:Tipin UTSW 9 64288115 start codon destroyed probably null 1.00
R2870:Tipin UTSW 9 64304327 missense probably benign 0.01
R2870:Tipin UTSW 9 64304327 missense probably benign 0.01
R4552:Tipin UTSW 9 64288103 splice site probably null
R4553:Tipin UTSW 9 64288103 splice site probably null
R4812:Tipin UTSW 9 64304412 missense probably benign
R7330:Tipin UTSW 9 64288226 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTATCACGGTCTTTGGTGG -3'
(R):5'- AGGATGGGATGTACTCCAGTAATAC -3'

Sequencing Primer
(F):5'- CATCAGATCCCATTACAGGTGGTTG -3'
(R):5'- CTCCAGTAATACTGTTTAGCATGGG -3'
Posted On2014-09-17