Incidental Mutation 'R2116:Reps1'
ID233171
Institutional Source Beutler Lab
Gene Symbol Reps1
Ensembl Gene ENSMUSG00000019854
Gene NameRalBP1 associated Eps domain containing protein
Synonyms
MMRRC Submission 040120-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.575) question?
Stock #R2116 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18055861-18125155 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18124920 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 760 (E760G)
Ref Sequence ENSEMBL: ENSMUSP00000130501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095817] [ENSMUST00000126390] [ENSMUST00000154718] [ENSMUST00000155284] [ENSMUST00000164556] [ENSMUST00000207827] [ENSMUST00000208948] [ENSMUST00000209178]
Predicted Effect probably benign
Transcript: ENSMUST00000095817
SMART Domains Protein: ENSMUSP00000093497
Gene: ENSMUSG00000071392

DomainStartEndE-ValueType
FBOX 93 133 3.5e-4 SMART
Pfam:DUF4347 297 468 1.4e-11 PFAM
RhoGEF 578 761 6.3e-46 SMART
Blast:PH 793 909 6e-49 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000126390
AA Change: E787G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123238
Gene: ENSMUSG00000019854
AA Change: E787G

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 545 561 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
Blast:MYSc 613 671 1e-15 BLAST
coiled coil region 750 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144287
Predicted Effect unknown
Transcript: ENSMUST00000150029
AA Change: E746G
SMART Domains Protein: ENSMUSP00000119651
Gene: ENSMUSG00000019854
AA Change: E746G

DomainStartEndE-ValueType
Blast:EH 2 86 5e-51 BLAST
low complexity region 143 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 241 252 N/A INTRINSIC
EH 265 360 2.18e-34 SMART
low complexity region 377 393 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 534 559 N/A INTRINSIC
Blast:MYSc 573 631 1e-15 BLAST
coiled coil region 709 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150533
Predicted Effect possibly damaging
Transcript: ENSMUST00000154718
AA Change: E697G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119358
Gene: ENSMUSG00000019854
AA Change: E697G

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 484 509 N/A INTRINSIC
Blast:MYSc 523 581 9e-16 BLAST
coiled coil region 660 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155284
SMART Domains Protein: ENSMUSP00000119629
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
Blast:EH 3 99 6e-65 BLAST
low complexity region 156 175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164556
AA Change: E760G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130501
Gene: ENSMUSG00000019854
AA Change: E760G

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
low complexity region 547 572 N/A INTRINSIC
Blast:MYSc 586 644 9e-16 BLAST
coiled coil region 723 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207827
Predicted Effect probably benign
Transcript: ENSMUST00000208948
Predicted Effect probably benign
Transcript: ENSMUST00000209178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215232
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a signaling adaptor protein with two EH domains that interacts with proteins that participate in signaling, endocytosis and cytoskeletal changes. The encoded protein has been found in association with intersectin 1 and Src homology 3-domain growth factor receptor-bound 2-like (endophilin) interacting protein 1 when intersectin 1 was isolated from clathrin-coated pits. The encoded protein has also been shown to interact with amphiphysin, a cytoplasmic protein at the surface of synaptic vesicles. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,860 V401E probably damaging Het
4833427G06Rik A G 9: 51,101,084 S79P possibly damaging Het
Adamts20 A G 15: 94,355,362 C377R probably damaging Het
Adgrv1 T C 13: 81,529,013 K1180E probably benign Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Armc2 A T 10: 41,963,667 L434Q probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Atm C T 9: 53,500,969 E960K probably benign Het
Bend5 G T 4: 111,415,239 R22L probably benign Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Cmah G A 13: 24,428,897 D26N probably benign Het
Cnot1 A C 8: 95,726,153 D2098E probably damaging Het
Cnot10 A C 9: 114,626,436 S207R probably damaging Het
Col14a1 A G 15: 55,407,764 T638A unknown Het
Coro1a T C 7: 126,702,022 E102G probably damaging Het
Ddx27 A C 2: 167,027,764 D373A probably benign Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dhx37 A G 5: 125,421,102 V681A probably damaging Het
Dmxl1 T A 18: 49,878,817 L1347H probably damaging Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm12790 G A 4: 101,967,651 T140I possibly damaging Het
Golga3 A T 5: 110,187,395 M192L probably damaging Het
H2-T22 A T 17: 36,039,057 probably null Het
Hectd2 C A 19: 36,614,424 T675K probably damaging Het
Hinfp T C 9: 44,299,615 N116S probably damaging Het
Hs6st3 T A 14: 119,869,287 L369Q probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ipo7 T A 7: 110,051,118 Y792N probably damaging Het
Jak1 A T 4: 101,179,675 I256N probably damaging Het
Kcnd2 T A 6: 21,216,432 L45Q probably damaging Het
Klhl3 A T 13: 58,018,991 V342E probably damaging Het
Krt28 A C 11: 99,365,117 S439A probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrch1 G A 14: 74,785,531 P634L probably damaging Het
Lrp1 C T 10: 127,576,493 W1314* probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Lyst A G 13: 13,635,701 E652G probably damaging Het
Mageb3 A G 2: 121,954,552 V223A probably damaging Het
Map1b G T 13: 99,430,644 S1856R unknown Het
Mecom T A 3: 29,965,458 Q759L probably damaging Het
Mfsd6 T A 1: 52,660,975 R671S probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Ndufab1 A G 7: 122,101,764 L20P probably benign Het
Nfatc2ip T A 7: 126,385,108 Y371F probably damaging Het
Nhlrc1 A C 13: 47,014,185 S199A probably benign Het
Nipa1 G T 7: 55,985,525 N113K possibly damaging Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nlrp1a T A 11: 71,114,500 K630* probably null Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nr1i3 T A 1: 171,218,594 L181Q probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1043 A T 2: 86,162,729 Y73* probably null Het
Olfr150 T A 9: 39,737,304 M163K probably damaging Het
Olfr294 T C 7: 86,616,078 D189G probably benign Het
Olfr625-ps1 T C 7: 103,683,312 I188T probably damaging Het
Osgin2 G A 4: 16,008,648 T51M probably damaging Het
Pkd1l2 T A 8: 117,030,722 T1526S possibly damaging Het
Pkhd1l1 G T 15: 44,569,482 A3378S probably damaging Het
Plg A T 17: 12,384,477 D90V probably damaging Het
Plppr3 A T 10: 79,865,738 D423E probably benign Het
Prpf8 T C 11: 75,487,721 V66A possibly damaging Het
Psg19 A T 7: 18,794,255 Y188N probably damaging Het
Ptgs1 C A 2: 36,237,696 S89* probably null Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Pygm A G 19: 6,386,408 N100S probably damaging Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Sctr A T 1: 120,031,582 D70V probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Spty2d1 C T 7: 46,996,185 G570D probably damaging Het
Stx1b T C 7: 127,810,905 E153G probably damaging Het
Synm G A 7: 67,733,595 R1440W probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tgfb1i1 G A 7: 128,252,805 R353H probably damaging Het
Thbs3 T C 3: 89,219,392 F271S probably damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem221 T C 8: 71,557,828 Y133C probably damaging Het
Tmem229b-ps A G 10: 53,475,456 noncoding transcript Het
Tnxb T C 17: 34,672,227 C515R probably damaging Het
Trp53rka T A 2: 165,491,495 N158I probably damaging Het
Tsta3 A G 15: 75,926,142 F223S probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp31 C T 7: 121,648,696 V1175M probably benign Het
Veph1 G T 3: 66,057,189 N806K probably benign Het
Vmn1r223 G T 13: 23,249,662 C142F probably damaging Het
Vmn2r80 A T 10: 79,194,724 S795C probably benign Het
Wdr41 A G 13: 95,015,029 probably null Het
Zfp617 A T 8: 71,932,165 H113L probably benign Het
Zfp715 T A 7: 43,297,946 R863S possibly damaging Het
Other mutations in Reps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Reps1 APN 10 18124895 missense probably damaging 1.00
IGL01161:Reps1 APN 10 18093895 missense probably damaging 1.00
IGL01606:Reps1 APN 10 18107687 missense probably damaging 1.00
IGL01937:Reps1 APN 10 18093836 missense probably benign 0.04
IGL01945:Reps1 APN 10 18093836 missense probably benign 0.04
IGL02208:Reps1 APN 10 18119022 missense probably damaging 1.00
IGL02335:Reps1 APN 10 18056117 critical splice donor site probably null
IGL02706:Reps1 APN 10 18123015 splice site probably benign
IGL02747:Reps1 APN 10 18123600 missense probably damaging 1.00
R0554:Reps1 UTSW 10 18123119 missense possibly damaging 0.71
R0628:Reps1 UTSW 10 18121093 missense probably damaging 1.00
R1074:Reps1 UTSW 10 18094446 missense probably benign 0.01
R1710:Reps1 UTSW 10 18118950 missense possibly damaging 0.75
R1829:Reps1 UTSW 10 18107714 missense probably damaging 1.00
R2146:Reps1 UTSW 10 18093313 missense probably benign
R2161:Reps1 UTSW 10 18096283 missense probably damaging 0.99
R3704:Reps1 UTSW 10 18107680 missense probably damaging 1.00
R4115:Reps1 UTSW 10 18104207 missense possibly damaging 0.93
R4654:Reps1 UTSW 10 18114400 missense probably damaging 1.00
R4856:Reps1 UTSW 10 18123625 missense probably damaging 1.00
R4910:Reps1 UTSW 10 18107688 missense probably damaging 1.00
R5127:Reps1 UTSW 10 18093880 missense probably benign
R5521:Reps1 UTSW 10 18104234 missense probably damaging 1.00
R5707:Reps1 UTSW 10 18056010 missense probably benign 0.06
R5724:Reps1 UTSW 10 18114483 missense possibly damaging 0.75
R6564:Reps1 UTSW 10 18122392 intron probably null
X0062:Reps1 UTSW 10 18104226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCCTTCCTAAAGTGAAATGTATG -3'
(R):5'- TCCAGAGAAAGTCCTCCTGACC -3'

Sequencing Primer
(F):5'- GTATGTTTTCGATACAAGTTACCGCC -3'
(R):5'- AGAAAGTCCTCCTGACCCTTTTATTG -3'
Posted On2014-09-18