Incidental Mutation 'R2168:Pappa'
ID235599
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission 040171-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R2168 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65156445 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 412 (D412A)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably damaging
Transcript: ENSMUST00000084501
AA Change: D412A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: D412A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T A 2: 127,878,781 I188N probably damaging Het
Akr1c14 T C 13: 4,081,106 V266A probably damaging Het
Als2cl C A 9: 110,888,742 P301H probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cpsf1 A T 15: 76,603,737 N53K possibly damaging Het
Ctsll3 C T 13: 60,800,935 G69R possibly damaging Het
F2 C T 2: 91,628,348 R539Q probably damaging Het
Fam78b G A 1: 167,078,650 G126D probably damaging Het
Fancd2 A G 6: 113,591,159 I1332V possibly damaging Het
Flg2 C T 3: 93,201,937 S424L probably damaging Het
Fpr1 T C 17: 17,877,209 T173A possibly damaging Het
Gas2l3 A G 10: 89,414,098 V386A probably benign Het
Gdap2 A C 3: 100,187,883 E269A probably benign Het
Gm16432 C T 1: 178,015,911 probably benign Het
Igf2bp2 T A 16: 22,079,608 probably null Het
Ipo11 T C 13: 106,879,610 probably null Het
Itpr2 G T 6: 146,111,678 P2667Q probably benign Het
Itsn2 G T 12: 4,633,044 probably benign Het
Jakmip2 A G 18: 43,565,930 L488P probably damaging Het
Lrp1b A T 2: 41,375,846 C248S probably damaging Het
Lrrc17 A T 5: 21,575,048 D340V probably damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mrc1 T C 2: 14,244,204 S184P possibly damaging Het
Msh4 A T 3: 153,867,835 Y533* probably null Het
Mug1 A G 6: 121,870,499 N612S probably benign Het
Nectin2 G T 7: 19,730,614 S288R probably damaging Het
Neurog2 A T 3: 127,634,105 H126L probably damaging Het
Nol10 A T 12: 17,373,584 E310V probably damaging Het
Olfr1209 A G 2: 88,910,178 S72P probably damaging Het
Olfr1366 T G 13: 21,537,252 K251T probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr573-ps1 A T 7: 102,942,471 F35L probably benign Het
Pcdhb7 T A 18: 37,343,282 F490L probably benign Het
Pcsk1 T A 13: 75,112,534 probably benign Het
Plekhn1 T A 4: 156,221,882 D577V probably damaging Het
Prrc2c C A 1: 162,710,334 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pzp G A 6: 128,488,047 T1288M probably damaging Het
Radil A C 5: 142,506,963 H63Q probably benign Het
Rai1 T C 11: 60,187,596 S829P probably benign Het
Rd3 A G 1: 191,983,527 I88V probably damaging Het
Rfesd T C 13: 76,008,125 D54G probably damaging Het
Rnf213 A C 11: 119,415,070 K568T probably damaging Het
Scaper T A 9: 55,743,639 K913N probably damaging Het
Serpina3c T C 12: 104,149,369 probably null Het
Serpinb6d A T 13: 33,666,374 K61N probably benign Het
Skint4 A T 4: 112,086,986 probably null Het
Sod1 T C 16: 90,220,913 I19T possibly damaging Het
Stfa3 C A 16: 36,450,680 G81* probably null Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Uggt2 T A 14: 119,019,505 N1106Y probably damaging Het
Vmn1r217 G A 13: 23,114,544 Q63* probably null Het
Vmn2r-ps159 A T 4: 156,338,378 noncoding transcript Het
Vps13b C A 15: 35,792,188 P2201T probably damaging Het
Vps13b C A 15: 35,792,189 P2201Q probably damaging Het
Vps13d G T 4: 145,087,323 probably benign Het
Zer1 A G 2: 30,104,875 C503R probably damaging Het
Zfp369 T C 13: 65,296,948 V635A probably benign Het
Zfp608 A T 18: 54,898,053 Y938* probably null Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
R7196:Pappa UTSW 4 65323891 splice site probably null
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTTTTCGGCAGCCCAAG -3'
(R):5'- CATCAGTGATGTCTGGGTCACAG -3'

Sequencing Primer
(F):5'- CGCTATCGTGTGGTCAACATCTATG -3'
(R):5'- TGGGTCACAGCACTCTCCAC -3'
Posted On2014-10-01