Incidental Mutation 'R6322:Pappa'
ID510144
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R6322 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65314659 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 1345 (A1345D)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably damaging
Transcript: ENSMUST00000084501
AA Change: A1345D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: A1345D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,729,499 V211A probably benign Het
Adora3 G A 3: 105,907,444 R170H probably benign Het
Aldh1l1 T C 6: 90,562,698 I203T probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Atcay A T 10: 81,213,291 I159K probably damaging Het
Blvra A G 2: 127,080,539 probably benign Het
Celsr2 A G 3: 108,412,574 F974S probably damaging Het
Cfap44 C T 16: 44,433,666 R918* probably null Het
Cpa6 T A 1: 10,477,121 R181S possibly damaging Het
Dlg1 A G 16: 31,856,479 N730D probably damaging Het
Eif2ak1 A G 5: 143,899,095 T535A probably benign Het
Fam13c A T 10: 70,498,891 D149V probably damaging Het
Fam171a1 G A 2: 3,226,355 V717I probably benign Het
Fchsd1 A G 18: 37,965,700 V290A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15446 A T 5: 109,943,517 H545L probably damaging Het
Gm16432 T A 1: 178,017,730 Y105* probably null Het
Heatr9 T G 11: 83,516,712 K215T possibly damaging Het
Hfe T A 13: 23,705,896 H210L probably damaging Het
Lama2 T C 10: 27,190,547 T1113A probably damaging Het
Lipe A T 7: 25,380,536 V686E probably damaging Het
Map3k20 T G 2: 72,433,470 L488V possibly damaging Het
Moxd1 C T 10: 24,284,811 T454I probably damaging Het
Mrpl58 C T 11: 115,410,666 R189* probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nkx1-1 T C 5: 33,431,045 N300D probably damaging Het
Nrm A T 17: 35,864,713 Q237L possibly damaging Het
Numa1 T C 7: 102,000,920 L1286P probably damaging Het
Olfr1291-ps1 T C 2: 111,499,384 F44S possibly damaging Het
Pds5a T C 5: 65,696,834 I22V probably benign Het
Phf21b C A 15: 84,787,379 R438L possibly damaging Het
Pik3r5 T C 11: 68,492,741 L462P probably benign Het
Plagl2 T C 2: 153,231,886 E365G probably benign Het
Plxna2 A G 1: 194,754,367 Y677C possibly damaging Het
Pramef12 A G 4: 144,392,905 M364T probably benign Het
Prkcd C A 14: 30,599,663 G410W probably damaging Het
Rgl1 T C 1: 152,552,435 I348V probably damaging Het
Rnmt C T 18: 68,319,214 P386S probably damaging Het
Rtn3 G A 19: 7,458,138 P163L possibly damaging Het
Sfxn1 T C 13: 54,104,850 C275R possibly damaging Het
Sh2b2 A G 5: 136,224,188 S377P probably damaging Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Simc1 T C 13: 54,550,569 L1334S probably damaging Het
Slc9a2 C A 1: 40,742,653 Y347* probably null Het
Snapc5 T A 9: 64,182,173 I71K probably damaging Het
Tmem161a T C 8: 70,182,114 F447S probably damaging Het
Tns3 A G 11: 8,492,147 C739R probably benign Het
Trappc11 A T 8: 47,530,773 V28D possibly damaging Het
Ubr3 C T 2: 69,956,085 Q848* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCATTGGAATTCTAACCAGGG -3'
(R):5'- TATGGCTATGACCCTACTGTCC -3'

Sequencing Primer
(F):5'- TTGGAATTCTAACCAGGGATCCC -3'
(R):5'- GACCCTACTGTCCTCCTTCTCAAG -3'
Posted On2018-04-02