Incidental Mutation 'R6002:Pappa'
ID478413
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R6002 (G1)
Quality Score172.009
Status Not validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65297408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1184 (V1184D)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably damaging
Transcript: ENSMUST00000084501
AA Change: V1184D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: V1184D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Adam28 A G 14: 68,642,062 L179P probably benign Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cd96 A T 16: 46,117,986 S39T possibly damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Coro1a G T 7: 126,703,080 Q32K probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr463 A T 11: 87,893,807 V39E probably damaging Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pcyox1 T A 6: 86,392,182 M152L probably benign Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Prl5a1 T C 13: 28,145,482 I48T probably benign Het
Rabgap1 A G 2: 37,473,602 T132A probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Zswim2 C A 2: 83,915,688 D469Y probably damaging Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGCCTTGAGTAATGAGCCTG -3'
(R):5'- GGACAAGCTGACCAGAAGTC -3'

Sequencing Primer
(F):5'- TTGAGTAATGAGCCTGGCCCC -3'
(R):5'- CCAGAAGTCAGAGAACGGAGACTG -3'
Posted On2017-06-26