Mutagenetix > Incidental Mutation

Incidental Mutation 'R2289:Grm7'

244207

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

6330570A01Rik, Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik

MMRRC Submission

040288-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2289 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110622542-111544191 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 110623309 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 161 (V161F)

Ref Sequence

ENSEMBL: ENSMUSP00000134635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably damaging
Transcript: ENSMUST00000071076
AA Change: V161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: V161F

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172951
AA Change: V161F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: V161F

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173609

Predicted Effect

probably damaging
Transcript: ENSMUST00000174018
AA Change: V161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: V161F

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Meta Mutation Damage Score

0.2357

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp12a	G	A	14: 56,610,719 (GRCm39)	V288I	possibly damaging	Het
Cntn6	C	T	6: 104,545,989 (GRCm39)		probably benign	Het
Col1a2	G	A	6: 4,518,822 (GRCm39)		probably benign	Het
Cplx3	T	A	9: 57,520,941 (GRCm39)	E220V	possibly damaging	Het
Cracdl	T	C	1: 37,651,342 (GRCm39)	K1175R	possibly damaging	Het
Dcaf10	T	A	4: 45,359,816 (GRCm39)	W244R	probably damaging	Het
Dixdc1	A	G	9: 50,595,172 (GRCm39)		probably null	Het
Dlg4	T	A	11: 69,917,752 (GRCm39)	Y12N	probably damaging	Het
Fsd1l	T	A	4: 53,696,931 (GRCm39)	Y442N	possibly damaging	Het
Hcrt	C	A	11: 100,652,745 (GRCm39)	A90S	probably damaging	Het
Itga6	T	A	2: 71,648,873 (GRCm39)	V119D	probably damaging	Het
Klrh1	T	C	6: 129,745,140 (GRCm39)	N152S	probably null	Het
Lmtk2	T	A	5: 144,112,924 (GRCm39)	S1215T	possibly damaging	Het
Loxl2	G	A	14: 69,930,524 (GRCm39)	E763K	probably benign	Het
Mcrip1	T	C	11: 120,435,530 (GRCm39)	E35G	probably damaging	Het
Nle1	T	A	11: 82,793,879 (GRCm39)	I386F	probably benign	Het
Nqo1	T	C	8: 108,119,630 (GRCm39)	I8V	probably benign	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Pax8	T	C	2: 24,330,752 (GRCm39)	D227G	probably benign	Het
Phf14	T	C	6: 12,047,845 (GRCm39)	C885R	probably damaging	Het
Rhobtb3	A	C	13: 76,059,046 (GRCm39)	C251G	probably damaging	Het
Samd13	C	T	3: 146,368,446 (GRCm39)	A49T	probably damaging	Het
Snrpa1	T	A	7: 65,713,586 (GRCm39)	V101E	probably benign	Het
Styx	A	G	14: 45,592,404 (GRCm39)	E20G	possibly damaging	Het
Thoc1	T	C	18: 9,984,488 (GRCm39)	Y325H	probably damaging	Het
Tmem163	T	A	1: 127,423,477 (GRCm39)	T262S	possibly damaging	Het
Tsr1	T	G	11: 74,790,111 (GRCm39)	L102R	probably damaging	Het
Vash1	G	C	12: 86,726,952 (GRCm39)	R64P	probably damaging	Het
Vps13b	A	C	15: 35,572,251 (GRCm39)	D956A	probably damaging	Het
Vrk1	G	A	12: 106,024,120 (GRCm39)	G199S	probably damaging	Het
Vrk3	C	T	7: 44,424,866 (GRCm39)	T427M	probably benign	Het
Zfp870	A	T	17: 33,102,334 (GRCm39)	S333T	probably benign	Het
Zranb1	T	C	7: 132,551,768 (GRCm39)	Y140H	probably damaging	Het
Zscan4b	A	G	7: 10,635,789 (GRCm39)		probably null	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111,223,145 (GRCm39)	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111,335,278 (GRCm39)	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111,335,919 (GRCm39)	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111,230,981 (GRCm39)	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111,472,604 (GRCm39)	splice site	probably null
IGL03185:Grm7	APN	6	110,623,183 (GRCm39)	missense	possibly damaging	0.84
Appropriated	UTSW	6	111,472,642 (GRCm39)	missense	possibly damaging	0.64
Consumed	UTSW	6	111,335,836 (GRCm39)	missense	probably damaging	1.00
Devoured	UTSW	6	111,335,785 (GRCm39)	missense	probably damaging	1.00
Ravaged	UTSW	6	111,335,874 (GRCm39)	missense	probably damaging	1.00
shaky	UTSW	6	111,472,752 (GRCm39)	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110,623,050 (GRCm39)	missense	probably benign
R0539:Grm7	UTSW	6	111,336,055 (GRCm39)	splice site	probably benign
R0622:Grm7	UTSW	6	111,335,457 (GRCm39)	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111,335,985 (GRCm39)	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111,472,752 (GRCm39)	nonsense	probably null
R1823:Grm7	UTSW	6	111,184,730 (GRCm39)	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111,057,384 (GRCm39)	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111,335,568 (GRCm39)	missense	probably benign
R1987:Grm7	UTSW	6	110,891,472 (GRCm39)	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111,184,769 (GRCm39)	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110,623,098 (GRCm39)	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111,335,958 (GRCm39)	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111,472,642 (GRCm39)	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111,472,866 (GRCm39)	splice site	probably null
R2923:Grm7	UTSW	6	111,472,866 (GRCm39)	splice site	probably null
R3014:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111,472,683 (GRCm39)	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110,891,301 (GRCm39)	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111,230,981 (GRCm39)	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110,891,325 (GRCm39)	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111,223,335 (GRCm39)	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111,335,265 (GRCm39)	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110,891,507 (GRCm39)	splice site	probably null
R4647:Grm7	UTSW	6	110,891,344 (GRCm39)	nonsense	probably null
R4714:Grm7	UTSW	6	111,057,383 (GRCm39)	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110,891,332 (GRCm39)	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111,335,824 (GRCm39)	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111,057,404 (GRCm39)	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110,623,097 (GRCm39)	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111,335,182 (GRCm39)	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111,335,387 (GRCm39)	missense	probably benign
R6026:Grm7	UTSW	6	111,478,500 (GRCm39)	nonsense	probably null
R6174:Grm7	UTSW	6	111,223,258 (GRCm39)	missense	probably benign
R6305:Grm7	UTSW	6	111,335,626 (GRCm39)	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111,335,836 (GRCm39)	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111,230,981 (GRCm39)	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111,184,713 (GRCm39)	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111,335,386 (GRCm39)	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111,335,314 (GRCm39)	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	111,472,690 (GRCm39)	missense	probably damaging	1.00
R6949:Grm7	UTSW	6	110,623,265 (GRCm39)	missense	probably benign	0.03
R6989:Grm7	UTSW	6	111,184,766 (GRCm39)	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111,335,113 (GRCm39)	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111,335,530 (GRCm39)	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111,335,530 (GRCm39)	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111,335,785 (GRCm39)	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110,623,079 (GRCm39)	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110,622,974 (GRCm39)	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111,478,476 (GRCm39)	missense
R7567:Grm7	UTSW	6	111,335,722 (GRCm39)	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111,223,314 (GRCm39)	nonsense	probably null
R8018:Grm7	UTSW	6	111,184,737 (GRCm39)	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111,543,000 (GRCm39)	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110,891,297 (GRCm39)	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111,057,315 (GRCm39)	missense	probably benign
R8523:Grm7	UTSW	6	111,223,280 (GRCm39)	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111,230,966 (GRCm39)	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111,472,783 (GRCm39)	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111,472,729 (GRCm39)	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111,335,874 (GRCm39)	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110,622,869 (GRCm39)	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111,231,077 (GRCm39)	missense	possibly damaging	0.94
R9448:Grm7	UTSW	6	111,335,193 (GRCm39)	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111,335,451 (GRCm39)	missense	probably damaging	1.00
Z1176:Grm7	UTSW	6	111,335,110 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCTCTCGACCAGATCAACAG -3'
(R):5'- GGATTCGACAGGATCTCCAG -3'

Sequencing Primer
(F):5'- TGCTGCCCAACGTAACG -3'
(R):5'- TTCGACAGGATCTCCAGGGTAG -3'

Posted On

2014-10-30