Mutagenetix > Incidental Mutation

Incidental Mutation 'R4009:Grm7'

311599

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

6330570A01Rik, Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik

MMRRC Submission

040846-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4009 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110622542-111544191 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 111472683 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 841 (Y841N)

Ref Sequence

ENSEMBL: ENSMUSP00000133957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably damaging
Transcript: ENSMUST00000071076
AA Change: Y841N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: Y841N

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172951
AA Change: Y841N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: Y841N

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000173001
AA Change: Y3N

Predicted Effect

probably benign
Transcript: ENSMUST00000174018

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174310

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 109,980,933 (GRCm39)	L35Q	probably damaging	Het
Acss2	T	A	2: 155,399,548 (GRCm39)	L529Q	probably damaging	Het
Apc2	T	A	10: 80,149,426 (GRCm39)	D1464E	probably benign	Het
Atp8a2	A	G	14: 60,265,434 (GRCm39)	S301P	possibly damaging	Het
Cntln	A	G	4: 84,981,452 (GRCm39)	T877A	probably benign	Het
Cntn6	T	C	6: 104,810,783 (GRCm39)	I537T	probably damaging	Het
Cyp2d12	T	G	15: 82,440,493 (GRCm39)	L94R	probably damaging	Het
Dnah7a	A	G	1: 53,564,164 (GRCm39)	L1965P	probably damaging	Het
Dock10	T	C	1: 80,510,148 (GRCm39)	N1560S	probably damaging	Het
F830045P16Rik	A	T	2: 129,305,467 (GRCm39)	N302K	probably damaging	Het
Fxr1	G	T	3: 34,119,171 (GRCm39)	R580L	probably benign	Het
Gm5592	G	T	7: 40,938,934 (GRCm39)	V739L	probably benign	Het
Gna13	A	G	11: 109,286,843 (GRCm39)	D222G	probably damaging	Het
Kat2b	G	A	17: 53,951,769 (GRCm39)		probably null	Het
Kcng4	A	G	8: 120,352,824 (GRCm39)	V362A	probably damaging	Het
Kcnh1	T	A	1: 191,959,448 (GRCm39)	I334N	probably benign	Het
Mapkbp1	T	C	2: 119,854,086 (GRCm39)	S1222P	probably benign	Het
Or10a3m	A	T	7: 108,313,366 (GRCm39)	I269L	probably benign	Het
Or10ag57	A	T	2: 87,218,924 (GRCm39)	I292F	possibly damaging	Het
Or11g26	T	C	14: 50,753,419 (GRCm39)	S253P	possibly damaging	Het
Or5h24	G	A	16: 58,919,124 (GRCm39)	T77I	unknown	Het
Pik3cb	A	G	9: 98,922,982 (GRCm39)	Y1017H	probably damaging	Het
Plpp5	A	G	8: 26,210,338 (GRCm39)	E36G	probably damaging	Het
Pnma8a	A	T	7: 16,695,301 (GRCm39)	K385N	probably damaging	Het
Ptprd	T	G	4: 75,874,634 (GRCm39)	M1272L	possibly damaging	Het
Rad51ap2	A	G	12: 11,507,052 (GRCm39)	I325V	probably benign	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Skint4	T	C	4: 111,977,306 (GRCm39)	V232A	possibly damaging	Het
Slc30a5	G	A	13: 100,945,741 (GRCm39)	A537V	probably damaging	Het
Tcerg1	CAATTGAAAA	CAA	18: 42,697,201 (GRCm39)		probably null	Het
Tenm3	C	A	8: 48,802,258 (GRCm39)	K162N	probably damaging	Het
Vmn2r44	T	A	7: 8,380,987 (GRCm39)	Q302L	possibly damaging	Het
Zfp618	G	A	4: 63,051,801 (GRCm39)	A861T	probably benign	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111,223,145 (GRCm39)	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111,335,278 (GRCm39)	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111,335,919 (GRCm39)	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111,230,981 (GRCm39)	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111,472,604 (GRCm39)	splice site	probably null
IGL03185:Grm7	APN	6	110,623,183 (GRCm39)	missense	possibly damaging	0.84
Appropriated	UTSW	6	111,472,642 (GRCm39)	missense	possibly damaging	0.64
Consumed	UTSW	6	111,335,836 (GRCm39)	missense	probably damaging	1.00
Devoured	UTSW	6	111,335,785 (GRCm39)	missense	probably damaging	1.00
Ravaged	UTSW	6	111,335,874 (GRCm39)	missense	probably damaging	1.00
shaky	UTSW	6	111,472,752 (GRCm39)	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110,623,050 (GRCm39)	missense	probably benign
R0539:Grm7	UTSW	6	111,336,055 (GRCm39)	splice site	probably benign
R0622:Grm7	UTSW	6	111,335,457 (GRCm39)	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111,335,985 (GRCm39)	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111,472,752 (GRCm39)	nonsense	probably null
R1823:Grm7	UTSW	6	111,184,730 (GRCm39)	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111,057,384 (GRCm39)	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111,335,568 (GRCm39)	missense	probably benign
R1987:Grm7	UTSW	6	110,891,472 (GRCm39)	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111,184,769 (GRCm39)	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110,623,098 (GRCm39)	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111,335,958 (GRCm39)	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111,472,642 (GRCm39)	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111,472,866 (GRCm39)	splice site	probably null
R2923:Grm7	UTSW	6	111,472,866 (GRCm39)	splice site	probably null
R3014:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110,891,301 (GRCm39)	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111,230,981 (GRCm39)	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110,891,325 (GRCm39)	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111,223,335 (GRCm39)	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111,335,265 (GRCm39)	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110,891,507 (GRCm39)	splice site	probably null
R4647:Grm7	UTSW	6	110,891,344 (GRCm39)	nonsense	probably null
R4714:Grm7	UTSW	6	111,057,383 (GRCm39)	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110,891,332 (GRCm39)	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111,335,824 (GRCm39)	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111,057,404 (GRCm39)	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110,623,097 (GRCm39)	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111,335,182 (GRCm39)	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111,335,387 (GRCm39)	missense	probably benign
R6026:Grm7	UTSW	6	111,478,500 (GRCm39)	nonsense	probably null
R6174:Grm7	UTSW	6	111,223,258 (GRCm39)	missense	probably benign
R6305:Grm7	UTSW	6	111,335,626 (GRCm39)	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111,335,836 (GRCm39)	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111,230,981 (GRCm39)	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111,184,713 (GRCm39)	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111,335,386 (GRCm39)	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111,335,314 (GRCm39)	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	111,472,690 (GRCm39)	missense	probably damaging	1.00
R6949:Grm7	UTSW	6	110,623,265 (GRCm39)	missense	probably benign	0.03
R6989:Grm7	UTSW	6	111,184,766 (GRCm39)	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111,335,113 (GRCm39)	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111,335,530 (GRCm39)	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111,335,530 (GRCm39)	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111,335,785 (GRCm39)	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110,623,079 (GRCm39)	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110,622,974 (GRCm39)	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111,478,476 (GRCm39)	missense
R7567:Grm7	UTSW	6	111,335,722 (GRCm39)	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111,223,314 (GRCm39)	nonsense	probably null
R8018:Grm7	UTSW	6	111,184,737 (GRCm39)	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111,543,000 (GRCm39)	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110,891,297 (GRCm39)	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111,057,315 (GRCm39)	missense	probably benign
R8523:Grm7	UTSW	6	111,223,280 (GRCm39)	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111,230,966 (GRCm39)	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111,472,783 (GRCm39)	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111,472,729 (GRCm39)	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111,335,874 (GRCm39)	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110,622,869 (GRCm39)	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111,231,077 (GRCm39)	missense	possibly damaging	0.94
R9448:Grm7	UTSW	6	111,335,193 (GRCm39)	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111,335,451 (GRCm39)	missense	probably damaging	1.00
Z1176:Grm7	UTSW	6	111,335,110 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACACAGCCAAGTTGTTTCCC -3'
(R):5'- AGAGTTACTTACTGTTTGGGTCTAC -3'

Sequencing Primer
(F):5'- TTAGCAGAAAGTCCTTGGCATGAC -3'
(R):5'- GGGTCTACATTTTCACAAAGTTCTG -3'

Posted On

2015-04-29