Incidental Mutation 'R2426:Pigu'
ID250195
Institutional Source Beutler Lab
Gene Symbol Pigu
Ensembl Gene ENSMUSG00000038383
Gene Namephosphatidylinositol glycan anchor biosynthesis, class U
SynonymsCdc91l1, 5430426F17Rik
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155278243-155357430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155299082 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 296 (V296D)
Ref Sequence ENSEMBL: ENSMUSP00000126236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077626] [ENSMUST00000165234]
Predicted Effect probably damaging
Transcript: ENSMUST00000077626
AA Change: V297D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076816
Gene: ENSMUSG00000038383
AA Change: V297D

DomainStartEndE-ValueType
Pfam:PIG-U 10 394 2.6e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139854
Predicted Effect probably damaging
Transcript: ENSMUST00000165234
AA Change: V296D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126236
Gene: ENSMUSG00000038383
AA Change: V296D

DomainStartEndE-ValueType
Pfam:PIG-U 10 393 1.7e-116 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Cdc91, a predicted integral membrane protein that may function in cell division control. The protein encoded by this gene is the fifth subunit of GPI transamidase that attaches GPI-anchors to proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Pigu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Pigu APN 2 155331192 missense possibly damaging 0.70
IGL02833:Pigu APN 2 155345645 splice site probably benign
IGL03213:Pigu APN 2 155335371 missense probably damaging 1.00
R1645:Pigu UTSW 2 155328678 nonsense probably null
R3816:Pigu UTSW 2 155299143 missense probably damaging 1.00
R3879:Pigu UTSW 2 155299143 missense probably damaging 1.00
R5017:Pigu UTSW 2 155299208 intron probably null
R5215:Pigu UTSW 2 155335329 intron probably benign
R5557:Pigu UTSW 2 155278629 nonsense probably null
R6106:Pigu UTSW 2 155297196 missense possibly damaging 0.67
R6718:Pigu UTSW 2 155301286 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGCATCCTCTGTGCAGCTTG -3'
(R):5'- AGTACTGGCCCCAAGTCTTGAG -3'

Sequencing Primer
(F):5'- GTACTTGGATGTGACTCTCAACTGC -3'
(R):5'- TCAGACTCTCTGTTCCAG -3'
Posted On2014-11-12