Incidental Mutation 'R2426:Psme2b'
ID250237
Institutional Source Beutler Lab
Gene Symbol Psme2b
Ensembl Gene ENSMUSG00000078153
Gene Nameprotease (prosome, macropain) activator subunit 2B
SynonymsPsme2-like, PA28b2, Psme2b, Psme2b-ps
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48945354-48946190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48946063 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 19 (V19D)
Ref Sequence ENSEMBL: ENSMUSP00000100564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000097494] [ENSMUST00000104958]
Predicted Effect probably benign
Transcript: ENSMUST00000059930
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097494
SMART Domains Protein: ENSMUSP00000095102
Gene: ENSMUSG00000069893

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 1.9e-153 PFAM
Pfam:MMR_HSR1 483 611 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104958
AA Change: V19D

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100564
Gene: ENSMUSG00000078153
AA Change: V19D

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene may encode proteasome activator complex subunit 2 protein (PMID: 10222192). This gene, located on chromosome 11, lacks a structured promoter and is intronless. It has also been described as a pseudogene (PMID: 9914329), however, it has an intact coding region and transcripts can be placed at this location unambiguously. An interferon-inducible gene located on chromosome 14, near the gene that encodes proteasome activator complex subunit 1 protein, is considered the functional gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Adgra3 A T 5: 50,009,449 M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Psme2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02490:Psme2b APN 11 48946119 utr 5 prime probably benign
IGL03309:Psme2b APN 11 48945799 unclassified probably null
R0087:Psme2b UTSW 11 48945717 missense possibly damaging 0.95
R0523:Psme2b UTSW 11 48945782 missense probably damaging 0.97
R1467:Psme2b UTSW 11 48945640 missense probably damaging 1.00
R1467:Psme2b UTSW 11 48945640 missense probably damaging 1.00
R1502:Psme2b UTSW 11 48945749 missense probably damaging 1.00
R1540:Psme2b UTSW 11 48945382 utr 3 prime probably null
R1793:Psme2b UTSW 11 48945534 missense probably damaging 1.00
R1967:Psme2b UTSW 11 48946069 missense probably damaging 0.99
R4667:Psme2b UTSW 11 48945666 missense probably benign 0.00
R5011:Psme2b UTSW 11 48945827 missense probably benign 0.00
R5013:Psme2b UTSW 11 48945827 missense probably benign 0.00
R6131:Psme2b UTSW 11 48945925 missense probably damaging 0.96
R6860:Psme2b UTSW 11 48945480 nonsense probably null
X0025:Psme2b UTSW 11 48945886 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCACACTTAGGGACTTCCTTC -3'
(R):5'- CGGAAGAGCAAGATTCAGATTC -3'

Sequencing Primer
(F):5'- GTTTCCATCTCGTCATCCTTGGG -3'
(R):5'- GAAGAGCAAGATTCAGATTCAAAATC -3'
Posted On2014-11-12