Incidental Mutation 'R2885:Alpk3'
ID261008
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Namealpha-kinase 3
SynonymsMidori
MMRRC Submission 040473-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R2885 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81057600-81105612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81100192 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1453 (S1453G)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
Predicted Effect probably damaging
Transcript: ENSMUST00000107348
AA Change: S1453G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: S1453G

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151115
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap27 T C 11: 103,360,843 probably null Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cerk A G 15: 86,142,883 F142S probably damaging Het
Cmip A G 8: 117,384,965 N145S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp4b1 C T 4: 115,635,652 D287N probably damaging Het
Dlx2 G A 2: 71,545,464 R172* probably null Het
Dnah11 G A 12: 117,987,427 Q1145* probably null Het
Dock2 A T 11: 34,689,766 I659N probably damaging Het
Dync2h1 G C 9: 7,102,329 F2690L probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Ift57 T C 16: 49,763,751 V289A probably damaging Het
Lrrc46 G A 11: 97,034,980 R219C probably damaging Het
Mapk1 A G 16: 17,026,445 N269S probably benign Het
Mrgprb1 A T 7: 48,447,721 Y148N probably damaging Het
Mzt2 G T 16: 15,862,916 A3E unknown Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Obscn A T 11: 59,086,748 V1959E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Phf12 T C 11: 78,023,769 I130T possibly damaging Het
Plekhg3 T C 12: 76,564,961 V338A probably benign Het
Prl3b1 A T 13: 27,249,522 N220I probably damaging Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Setdb1 A G 3: 95,340,195 I463T probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Siglec1 A G 2: 131,072,747 F1483S possibly damaging Het
Sis G A 3: 72,909,173 P1515S probably benign Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Ttc39d A G 17: 80,216,715 S268G probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r60 T A 7: 42,140,979 D463E possibly damaging Het
Vmn2r91 A T 17: 18,105,366 Y82F probably benign Het
Zfp709 A T 8: 71,889,705 D325V probably benign Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAAGCTTCAACAGTGAGCC -3'
(R):5'- GCCTTAGGGGAAGAGACTTTC -3'

Sequencing Primer
(F):5'- AACAGTGAGCCCTGCTTTG -3'
(R):5'- CTTTCTAAAGTGGATCAGTGAGC -3'
Posted On2015-01-23