Mutagenetix > Incidental Mutation

Incidental Mutation 'R3107:Sorcs1'

263648

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

040581-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R3107 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50131737-50667084 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50199088 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 825 (E825G)

Ref Sequence

ENSEMBL: ENSMUSP00000147591 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072685
AA Change: E825G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: E825G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111756
AA Change: E825G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: E825G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164039
AA Change: E825G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: E825G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168357

SMART Domains

Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
VPS10	1	320	6.99e-58	SMART
PKD	322	412	3.84e-1	SMART
PKD	420	498	8.63e-1	SMART
transmembrane domain	621	643	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209413
AA Change: E825G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209783
AA Change: E825G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211008
AA Change: E825G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211687
AA Change: E825G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf4	A	T	17: 42,977,758 (GRCm39)	Y528*	probably null	Het
Ankrd26	A	T	6: 118,533,204 (GRCm39)	F198L	probably benign	Het
Arnt2	A	G	7: 83,911,652 (GRCm39)	S607P	possibly damaging	Het
Brd10	A	T	19: 29,700,847 (GRCm39)	L814H	probably damaging	Het
Ccdc17	T	C	4: 116,455,464 (GRCm39)	V269A	probably benign	Het
Cers1	T	A	8: 70,775,286 (GRCm39)	H233Q	probably benign	Het
Cfap54	T	C	10: 92,830,545 (GRCm39)	N1197S	probably benign	Het
Cfb	A	G	17: 35,080,800 (GRCm39)	Y66H	possibly damaging	Het
Clspn	A	G	4: 126,485,452 (GRCm39)	D1247G	probably benign	Het
Cnnm1	T	C	19: 43,430,000 (GRCm39)	C373R	probably damaging	Het
Col19a1	T	C	1: 24,377,017 (GRCm39)	T443A	possibly damaging	Het
Cubn	T	C	2: 13,367,158 (GRCm39)	S1571G	possibly damaging	Het
Ddt	C	T	10: 75,608,597 (GRCm39)	E42K	probably benign	Het
Dmrt2	C	A	19: 25,655,055 (GRCm39)	T218N	probably benign	Het
Dnah7b	G	A	1: 46,392,033 (GRCm39)	G3798E	probably benign	Het
Espl1	A	G	15: 102,221,424 (GRCm39)	I944V	probably damaging	Het
Fam114a2	C	A	11: 57,390,561 (GRCm39)	K317N	probably benign	Het
Fyn	G	C	10: 39,427,451 (GRCm39)	D445H	probably damaging	Het
Gprasp1	A	T	X: 134,700,508 (GRCm39)	M234L	probably benign	Het
Ibtk	T	C	9: 85,592,467 (GRCm39)	Y997C	probably damaging	Het
Il12rb2	A	G	6: 67,337,782 (GRCm39)	V33A	probably damaging	Het
Ints6	T	C	14: 62,998,041 (GRCm39)	T23A	possibly damaging	Het
Itk	C	A	11: 46,218,291 (GRCm39)	G624V	probably benign	Het
Lama2	C	T	10: 26,877,231 (GRCm39)	E2652K	probably benign	Het
Mab21l3	T	A	3: 101,734,112 (GRCm39)	I109F	probably damaging	Het
Mov10	T	C	3: 104,707,040 (GRCm39)	E653G	probably damaging	Het
Or8b51	C	T	9: 38,569,307 (GRCm39)	C127Y	possibly damaging	Het
Plg	T	C	17: 12,603,316 (GRCm39)	V74A	probably benign	Het
Ptprn2	A	G	12: 116,839,800 (GRCm39)	D441G	probably benign	Het
Rbmxl2	G	A	7: 106,809,624 (GRCm39)	G303E	probably damaging	Het
Satb1	A	T	17: 52,089,810 (GRCm39)	Y346N	possibly damaging	Het
Serpina1a	A	T	12: 103,820,100 (GRCm39)	I382N	probably damaging	Het
Slc6a2	C	A	8: 93,687,906 (GRCm39)	Q11K	probably benign	Het
Slc6a20a	A	C	9: 123,470,773 (GRCm39)		probably null	Het
Sval1	C	G	6: 41,932,876 (GRCm39)	P145A	probably damaging	Het
Trhde	C	T	10: 114,427,971 (GRCm39)	E442K	probably damaging	Het
Vmn2r61	A	T	7: 41,916,491 (GRCm39)	D368V	possibly damaging	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50,178,492 (GRCm39)	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50,164,566 (GRCm39)	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50,216,639 (GRCm39)	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50,276,517 (GRCm39)	splice site	probably benign
IGL01445:Sorcs1	APN	19	50,141,504 (GRCm39)	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50,169,944 (GRCm39)	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50,218,647 (GRCm39)	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50,276,597 (GRCm39)	splice site	probably benign
IGL02111:Sorcs1	APN	19	50,218,683 (GRCm39)	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50,322,036 (GRCm39)	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50,171,109 (GRCm39)	nonsense	probably null
IGL02498:Sorcs1	APN	19	50,666,606 (GRCm39)	missense	probably benign
IGL02658:Sorcs1	APN	19	50,178,530 (GRCm39)	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50,666,368 (GRCm39)	nonsense	probably null
IGL02942:Sorcs1	APN	19	50,463,875 (GRCm39)	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50,248,194 (GRCm39)	nonsense	probably null
IGL03230:Sorcs1	APN	19	50,230,531 (GRCm39)	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50,141,345 (GRCm39)	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50,367,329 (GRCm39)	splice site	probably benign
R0115:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50,301,480 (GRCm39)	splice site	probably null
R0481:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0581:Sorcs1	UTSW	19	50,241,139 (GRCm39)	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50,230,380 (GRCm39)	splice site	probably benign
R0980:Sorcs1	UTSW	19	50,220,761 (GRCm39)	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50,132,598 (GRCm39)	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50,241,025 (GRCm39)	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50,463,860 (GRCm39)	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50,163,481 (GRCm39)	splice site	probably benign
R1783:Sorcs1	UTSW	19	50,216,747 (GRCm39)	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50,210,633 (GRCm39)	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50,666,630 (GRCm39)	missense	probably benign
R2206:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3508:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50,139,659 (GRCm39)	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50,210,597 (GRCm39)	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50,178,599 (GRCm39)	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50,367,379 (GRCm39)	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50,301,402 (GRCm39)	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50,171,107 (GRCm39)	missense	probably benign
R4780:Sorcs1	UTSW	19	50,132,419 (GRCm39)	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50,171,119 (GRCm39)	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50,218,740 (GRCm39)	missense	possibly damaging	0.87
R4823:Sorcs1	UTSW	19	50,666,578 (GRCm39)	missense	possibly damaging	0.92
R4883:Sorcs1	UTSW	19	50,220,741 (GRCm39)	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50,213,579 (GRCm39)	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50,241,040 (GRCm39)	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50,210,571 (GRCm39)	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50,171,213 (GRCm39)	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50,178,555 (GRCm39)	nonsense	probably null
R6091:Sorcs1	UTSW	19	50,276,539 (GRCm39)	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50,276,532 (GRCm39)	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50,169,852 (GRCm39)	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50,132,562 (GRCm39)	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50,213,615 (GRCm39)	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50,164,560 (GRCm39)	nonsense	probably null
R6792:Sorcs1	UTSW	19	50,666,606 (GRCm39)	missense	probably benign
R6891:Sorcs1	UTSW	19	50,213,557 (GRCm39)	nonsense	probably null
R7151:Sorcs1	UTSW	19	50,301,420 (GRCm39)	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50,178,480 (GRCm39)	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50,163,595 (GRCm39)	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50,250,701 (GRCm39)	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50,141,550 (GRCm39)	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50,141,490 (GRCm39)	missense	probably benign
R7506:Sorcs1	UTSW	19	50,171,112 (GRCm39)	nonsense	probably null
R7573:Sorcs1	UTSW	19	50,141,234 (GRCm39)	nonsense	probably null
R7867:Sorcs1	UTSW	19	50,218,698 (GRCm39)	nonsense	probably null
R7911:Sorcs1	UTSW	19	50,132,470 (GRCm39)	missense	unknown
R8032:Sorcs1	UTSW	19	50,463,846 (GRCm39)	missense	probably benign	0.28
R8063:Sorcs1	UTSW	19	50,132,415 (GRCm39)	missense	unknown
R8463:Sorcs1	UTSW	19	50,248,248 (GRCm39)	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50,367,398 (GRCm39)	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50,139,658 (GRCm39)	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50,241,096 (GRCm39)	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50,213,658 (GRCm39)	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50,220,753 (GRCm39)	missense	possibly damaging	0.92
R9203:Sorcs1	UTSW	19	50,250,733 (GRCm39)	missense	probably damaging	1.00
R9229:Sorcs1	UTSW	19	50,141,300 (GRCm39)	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50,213,651 (GRCm39)	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50,199,208 (GRCm39)	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9744:Sorcs1	UTSW	19	50,215,275 (GRCm39)	missense	probably damaging	1.00
R9777:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
X0024:Sorcs1	UTSW	19	50,171,201 (GRCm39)	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50,210,581 (GRCm39)	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50,322,037 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs1	UTSW	19	50,215,180 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACCGAACTTGTCAGGGAAAG -3'
(R):5'- GGGAATATCCATTGCATCAGC -3'

Sequencing Primer
(F):5'- CTTGTCAGGGAAAGGGAGAGGATAC -3'
(R):5'- GGGAATATCCATTGCATCAGCTGATG -3'

Posted On

2015-02-05