Incidental Mutation 'R3733:1700006E09Rik'
List |< first << previous [record 39 of 33389] next >> last >|
ID271098
Institutional Source Beutler Lab
Gene Symbol 1700006E09Rik
Ensembl Gene ENSMUSG00000010841
Gene NameRIKEN cDNA 1700006E09 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3733 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101984279-101992264 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 101988452 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 17 (Q17*)
Ref Sequence ENSEMBL: ENSMUSP00000134890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003612] [ENSMUST00000010985] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000143177] [ENSMUST00000151678] [ENSMUST00000175972] [ENSMUST00000176261] [ENSMUST00000176722]
Predicted Effect probably benign
Transcript: ENSMUST00000003612
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000010985
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000010985
Gene: ENSMUSG00000010841
AA Change: Q68*

DomainStartEndE-ValueType
Pfam:KIAA1430 35 130 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143177
SMART Domains Protein: ENSMUSP00000135821
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
PDB:1J4X|A 2 55 1e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175972
Predicted Effect probably benign
Transcript: ENSMUST00000176261
SMART Domains Protein: ENSMUSP00000135443
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
Pfam:DSPc 37 126 1.5e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176722
AA Change: Q17*
SMART Domains Protein: ENSMUSP00000134890
Gene: ENSMUSG00000010841
AA Change: Q17*

DomainStartEndE-ValueType
Pfam:KIAA1430 1 80 4.8e-22 PFAM
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in 1700006E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:1700006E09Rik APN 11 101990820 missense possibly damaging 0.75
IGL02442:1700006E09Rik APN 11 101990826 missense probably benign 0.00
R1802:1700006E09Rik UTSW 11 101988476 missense possibly damaging 0.56
R1937:1700006E09Rik UTSW 11 101987163 missense probably damaging 0.97
R2015:1700006E09Rik UTSW 11 101987218 missense probably damaging 1.00
R3732:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3732:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3813:1700006E09Rik UTSW 11 101991488 missense probably benign 0.01
R5804:1700006E09Rik UTSW 11 101990814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTCATTTCCCCAGAGC -3'
(R):5'- GGTTGAGTTCTCTGAGAATAAAGTGC -3'

Sequencing Primer
(F):5'- ATTTCCCCAGAGCCTTCTAAATAC -3'
(R):5'- TCTCTGAGAATAAAGTGCAGAGATAG -3'
Posted On2015-03-18