Incidental Mutation 'R3775:Pomgnt1'
ID273541
Institutional Source Beutler Lab
Gene Symbol Pomgnt1
Ensembl Gene ENSMUSG00000028700
Gene Nameprotein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase
Synonyms0610016I07Rik, 4930467B06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3775 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116123840-116159849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116154128 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 230 (R230H)
Ref Sequence ENSEMBL: ENSMUSP00000102105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106494] [ENSMUST00000106496] [ENSMUST00000106498] [ENSMUST00000120083] [ENSMUST00000121052]
Predicted Effect probably damaging
Transcript: ENSMUST00000106494
AA Change: R241H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102103
Gene: ENSMUSG00000028700
AA Change: R241H

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
PDB:2YOQ|C 106 195 6e-10 PDB
Pfam:GNT-I 271 591 3e-52 PFAM
low complexity region 623 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106496
AA Change: R230H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102105
Gene: ENSMUSG00000028700
AA Change: R230H

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOP|C 129 217 5e-10 PDB
Pfam:GNT-I 260 580 2.9e-52 PFAM
low complexity region 612 625 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106498
AA Change: R263H

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102107
Gene: ENSMUSG00000028700
AA Change: R263H

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120083
AA Change: R263H

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112751
Gene: ENSMUSG00000028700
AA Change: R263H

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
Pfam:ILEI 129 220 8.9e-28 PFAM
Pfam:GNT-I 293 612 1.9e-51 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121052
AA Change: R263H

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112911
Gene: ENSMUSG00000028700
AA Change: R263H

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155718
Meta Mutation Damage Score 0.394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Surviving homozygous null mice display a mild dystrophy despite a reduced muscle mass and myofiber number, impaired muscle regeneration and low proliferative activity of satellite cells. Mice homozygous for a gene trap allele show reduced fertility and multiple defects in muscle, eye and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,009,023 E2557G possibly damaging Het
Arid1a A G 4: 133,686,764 S1248P unknown Het
C2cd3 T C 7: 100,431,998 L1327S probably damaging Het
Ccnh T C 13: 85,206,124 probably benign Het
Dcdc5 C A 2: 106,372,393 noncoding transcript Het
Eprs T C 1: 185,373,008 F160S probably damaging Het
F9 A G X: 60,018,985 I190V probably benign Het
Fam185a C A 5: 21,455,806 A273D probably damaging Het
Fhod1 G A 8: 105,331,638 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hipk2 T C 6: 38,743,094 D534G probably damaging Het
Ints6l T C X: 56,481,371 L220S probably damaging Het
Kat7 T C 11: 95,291,531 T250A probably benign Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mpp3 G T 11: 102,023,367 S134* probably null Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nlrp1b T C 11: 71,156,300 probably benign Het
Npy1r T C 8: 66,704,850 F271L possibly damaging Het
Nup160 G T 2: 90,722,076 C1132F probably benign Het
Olfr1341 C T 4: 118,710,154 T249I probably damaging Het
Olfr97 T A 17: 37,232,230 I47F probably damaging Het
Pcdhga5 A G 18: 37,695,114 E205G possibly damaging Het
Pdgfc A G 3: 81,141,551 T89A probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Pgr15l G T X: 97,077,141 R181M probably damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rnf112 A T 11: 61,450,185 probably benign Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Slc25a19 A G 11: 115,615,459 Y303H probably damaging Het
Sympk T C 7: 19,035,955 F186L probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn2r29 C G 7: 7,240,012 D500H probably damaging Het
Other mutations in Pomgnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pomgnt1 APN 4 116152761 missense probably damaging 1.00
IGL02001:Pomgnt1 APN 4 116152908 nonsense probably null
IGL02582:Pomgnt1 APN 4 116158550 missense probably damaging 1.00
pomegranate UTSW 4 116154890 missense probably damaging 1.00
R0206:Pomgnt1 UTSW 4 116158560 critical splice donor site probably null
R0688:Pomgnt1 UTSW 4 116155889 missense probably damaging 1.00
R0890:Pomgnt1 UTSW 4 116152185 missense probably benign 0.25
R0927:Pomgnt1 UTSW 4 116151851 missense probably damaging 1.00
R1942:Pomgnt1 UTSW 4 116155275 splice site probably null
R1983:Pomgnt1 UTSW 4 116151869 missense probably damaging 1.00
R1983:Pomgnt1 UTSW 4 116151920 missense probably benign 0.12
R2034:Pomgnt1 UTSW 4 116157927 missense possibly damaging 0.87
R3721:Pomgnt1 UTSW 4 116153543 splice site probably benign
R3774:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3815:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3816:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3817:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3818:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R4447:Pomgnt1 UTSW 4 116152923 missense possibly damaging 0.75
R4583:Pomgnt1 UTSW 4 116158494 missense probably benign 0.03
R4616:Pomgnt1 UTSW 4 116154890 missense probably damaging 1.00
R4690:Pomgnt1 UTSW 4 116155510 missense probably damaging 1.00
R4717:Pomgnt1 UTSW 4 116154215 missense possibly damaging 0.50
R4719:Pomgnt1 UTSW 4 116155775 missense probably damaging 1.00
R4747:Pomgnt1 UTSW 4 116156199 missense probably damaging 1.00
R5108:Pomgnt1 UTSW 4 116156256 intron probably benign
R5569:Pomgnt1 UTSW 4 116155967 missense probably damaging 1.00
R5821:Pomgnt1 UTSW 4 116155736 missense probably benign 0.16
R5937:Pomgnt1 UTSW 4 116153913 missense probably benign 0.01
R6052:Pomgnt1 UTSW 4 116151602 missense possibly damaging 0.91
R6745:Pomgnt1 UTSW 4 116153883 missense probably damaging 0.97
R6949:Pomgnt1 UTSW 4 116154154 missense probably damaging 0.97
R7503:Pomgnt1 UTSW 4 116152752 missense possibly damaging 0.76
T0722:Pomgnt1 UTSW 4 116137427 unclassified probably benign
T0975:Pomgnt1 UTSW 4 116137427 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGAAGACAGATGTGCCACTG -3'
(R):5'- CAGAGGAAACCTACGTTGTGG -3'

Sequencing Primer
(F):5'- AGACAGATGTGCCACTGAGCTC -3'
(R):5'- AAACCTACGTTGTGGACTGGTCC -3'
Posted On2015-03-25