Incidental Mutation 'R3940:Gm14393'
ID307401
Institutional Source Beutler Lab
Gene Symbol Gm14393
Ensembl Gene ENSMUSG00000078905
Gene Namepredicted gene 14393
Synonyms
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3940 (G1)
Quality Score191
Status Not validated
Chromosome2
Chromosomal Location175061549-175067781 bp(-) (GRCm38)
Type of Mutationunclassified (1679 bp from exon)
DNA Base Change (assembly) T to C at 175061627 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072895] [ENSMUST00000109066]
Predicted Effect probably null
Transcript: ENSMUST00000072895
SMART Domains Protein: ENSMUSP00000072668
Gene: ENSMUSG00000078905

DomainStartEndE-ValueType
KRAB 4 66 9.34e-15 SMART
ZnF_C2H2 103 125 8.47e-4 SMART
ZnF_C2H2 131 153 9.22e-5 SMART
ZnF_C2H2 159 181 1.03e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109066
SMART Domains Protein: ENSMUSP00000104694
Gene: ENSMUSG00000078905

DomainStartEndE-ValueType
KRAB 4 64 1.21e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122320
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Gm14393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:Gm14393 APN 2 175061802 missense possibly damaging 0.53
IGL03049:Gm14393 APN 2 175061788 missense probably damaging 1.00
FR4340:Gm14393 UTSW 2 175061634 missense possibly damaging 0.48
FR4976:Gm14393 UTSW 2 175061820 missense probably benign
R1470:Gm14393 UTSW 2 175063981 missense probably damaging 1.00
R1470:Gm14393 UTSW 2 175063981 missense probably damaging 1.00
R4214:Gm14393 UTSW 2 175061847 missense probably benign 0.00
R4585:Gm14393 UTSW 2 175062704 unclassified probably benign
R4586:Gm14393 UTSW 2 175062704 unclassified probably benign
R5431:Gm14393 UTSW 2 175063876 missense probably damaging 0.97
R5553:Gm14393 UTSW 2 175061846 nonsense probably null
R5942:Gm14393 UTSW 2 175061896 nonsense probably null
R6497:Gm14393 UTSW 2 175061634 missense possibly damaging 0.48
R7154:Gm14393 UTSW 2 175061783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAATCCTTCCTGCAAAGGC -3'
(R):5'- AGCCTTTGCATATGAGAGTTGTAG -3'

Sequencing Primer
(F):5'- CTGCAAAGGCTTTACCACATTGG -3'
(R):5'- ACCATGACTGTAACCAATGTGG -3'
Posted On2015-04-17