Incidental Mutation 'R3974:Crot'
ID312517
Institutional Source Beutler Lab
Gene Symbol Crot
Ensembl Gene ENSMUSG00000003623
Gene Namecarnitine O-octanoyltransferase
Synonyms1200003H03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8966033-8997324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8977541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 264 (T264A)
Ref Sequence ENSEMBL: ENSMUSP00000003720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003720]
PDB Structure
Crystal Structure of Mouse Carnitine Octanoyltransferase [X-RAY DIFFRACTION]
Crystal structure of mouse carnitine octanoyltransferase in complex with octanoylcarnitine [X-RAY DIFFRACTION]
C323M mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
M335V mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000003720
AA Change: T264A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003720
Gene: ENSMUSG00000003623
AA Change: T264A

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 20 604 2.3e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146115
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Crot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Crot APN 5 8976072 missense probably damaging 1.00
IGL01013:Crot APN 5 8993575 missense probably benign 0.06
IGL01085:Crot APN 5 8973955 missense probably damaging 1.00
IGL02017:Crot APN 5 8970046 splice site probably benign
IGL02306:Crot APN 5 8968701 missense possibly damaging 0.94
IGL02612:Crot APN 5 8969945 missense probably damaging 1.00
IGL02884:Crot APN 5 8978197 critical splice donor site probably null
IGL03091:Crot APN 5 8966897 missense probably benign
IGL03356:Crot APN 5 8988295 splice site probably benign
ouray UTSW 5 8993504 critical splice donor site probably null
R0383:Crot UTSW 5 8968734 missense probably damaging 1.00
R0396:Crot UTSW 5 8969959 missense probably damaging 1.00
R0502:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0503:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0676:Crot UTSW 5 8993622 utr 5 prime probably benign
R1079:Crot UTSW 5 8993504 critical splice donor site probably null
R1472:Crot UTSW 5 8966941 missense probably damaging 1.00
R1595:Crot UTSW 5 8974186 missense probably benign 0.00
R1757:Crot UTSW 5 8987828 missense probably damaging 1.00
R1828:Crot UTSW 5 8969080 missense probably benign 0.01
R1846:Crot UTSW 5 8988248 missense probably benign 0.36
R2142:Crot UTSW 5 8987780 missense possibly damaging 0.94
R3973:Crot UTSW 5 8977541 missense probably benign
R3975:Crot UTSW 5 8977541 missense probably benign
R4445:Crot UTSW 5 8973643 missense probably damaging 1.00
R4446:Crot UTSW 5 8973643 missense probably damaging 1.00
R4995:Crot UTSW 5 8974000 missense probably damaging 1.00
R5084:Crot UTSW 5 8969994 missense probably damaging 1.00
R5464:Crot UTSW 5 8983690 splice site probably null
R5673:Crot UTSW 5 8988131 missense probably benign 0.00
R5814:Crot UTSW 5 8973996 missense probably damaging 0.99
R5935:Crot UTSW 5 8974192 missense probably benign
R5951:Crot UTSW 5 8969120 nonsense probably null
R6862:Crot UTSW 5 8989641 missense probably damaging 0.99
R6885:Crot UTSW 5 8973635 missense probably benign 0.00
R6983:Crot UTSW 5 8978280 missense probably benign 0.06
R7150:Crot UTSW 5 8987878 missense probably damaging 0.99
R7228:Crot UTSW 5 8976051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTACACAATATAGTTCATAGGTGA -3'
(R):5'- CGGTGGGCAAAGGTAATAATC -3'

Sequencing Primer
(F):5'- TAGGTGAGAAAAATTCTAAGACCCTG -3'
(R):5'- TCCCAGAAGCTGTCGTGTGAATAG -3'
Posted On2015-04-30