Incidental Mutation 'R3973:Pla2r1'
ID312920
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Namephospholipase A2 receptor 1
SynonymsM-type receptor, Pla2g1br, PLA2-I receptor
MMRRC Submission 040841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3973 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60417543-60553308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60448962 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 758 (V758A)
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
Predicted Effect probably benign
Transcript: ENSMUST00000067708
AA Change: V758A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065205
Gene: ENSMUSG00000054580
AA Change: V758A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
RICIN 42 154 2.98e-16 SMART
FN2 174 222 1.17e-25 SMART
CLECT 232 357 7.66e-30 SMART
CLECT 380 504 1.88e-29 SMART
CLECT 517 644 5.42e-21 SMART
CLECT 664 797 3.58e-21 SMART
CLECT 812 938 7.55e-20 SMART
CLECT 957 1096 5.05e-30 SMART
CLECT 1113 1232 4.72e-21 SMART
CLECT 1246 1377 1.44e-25 SMART
transmembrane domain 1397 1419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112525
AA Change: V758A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: V758A

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134583
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
4933427D14Rik T C 11: 72,198,741 R106G probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Ddx3y G A Y: 1,267,170 A232V probably damaging Het
Dst T G 1: 34,011,898 V25G probably benign Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Eps8 A T 6: 137,509,155 M453K probably benign Het
Galnt3 T C 2: 66,107,030 D112G possibly damaging Het
Glra4 C T X: 136,762,793 A336T probably damaging Het
Gmppb A G 9: 108,050,139 D95G probably benign Het
Gprc6a T C 10: 51,628,448 Y100C possibly damaging Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Hsd17b3 A T 13: 64,059,486 V247D probably damaging Het
Htr7 T C 19: 36,056,760 D165G probably damaging Het
Igha T C 12: 113,256,352 probably benign Het
Igsf10 A G 3: 59,331,924 C279R probably damaging Het
Irak4 A G 15: 94,554,740 E182G possibly damaging Het
Lipo3 A T 19: 33,558,323 V274E probably damaging Het
Lrpprc A C 17: 84,770,841 probably null Het
Mast1 T C 8: 84,918,764 Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 F2382L probably benign Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Mrgpra3 T A 7: 47,589,666 I171F probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Myh3 C T 11: 67,096,436 Q1371* probably null Het
Nodal T A 10: 61,423,054 V90E probably benign Het
Npas4 A T 19: 4,986,551 H528Q probably benign Het
Nt5dc3 T C 10: 86,824,236 V382A probably damaging Het
Pcdh18 G A 3: 49,754,586 T293I probably damaging Het
Phf20l1 A G 15: 66,641,816 D947G probably damaging Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Prkd3 G A 17: 78,959,141 probably benign Het
Prrc2a A G 17: 35,157,932 L734P probably damaging Het
Rnf128 C A X: 139,664,522 L282I probably damaging Het
Rnf213 A G 11: 119,469,053 N4424S probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Slc2a7 A G 4: 150,158,210 probably null Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Spc25 A G 2: 69,202,601 L60P probably damaging Het
Stam A C 2: 14,138,961 H354P probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tmem120a C G 5: 135,736,277 R254P probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trav7-4 A G 14: 53,461,662 S89G probably benign Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Vip T A 10: 5,642,590 S77T possibly damaging Het
Wdr72 A T 9: 74,218,697 M1025L probably benign Het
Zfp541 A G 7: 16,072,222 D94G probably damaging Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0906:Pla2r1 UTSW 2 60514947 missense possibly damaging 0.79
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2035:Pla2r1 UTSW 2 60422736 missense probably damaging 1.00
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3196:Pla2r1 UTSW 2 60522783 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4168:Pla2r1 UTSW 2 60497614 nonsense probably null
R4541:Pla2r1 UTSW 2 60427738 missense probably damaging 1.00
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6241:Pla2r1 UTSW 2 60502199 splice site probably null
R6923:Pla2r1 UTSW 2 60514966 missense probably benign 0.11
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7028:Pla2r1 UTSW 2 60458393 missense probably damaging 0.98
R7257:Pla2r1 UTSW 2 60427625 critical splice donor site probably null
R7291:Pla2r1 UTSW 2 60530435 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GCTGCGTATCATTCAAATGCAAAC -3'
(R):5'- TTTCTGAAGATTCCTCTGAAGTCCC -3'

Sequencing Primer
(F):5'- CATACATACAGTAAAGAGCTGGTAC -3'
(R):5'- TCTGAAGTCCCTTAAACAGTGGC -3'
Posted On2015-04-30