Incidental Mutation 'R4541:Pla2r1'
ID333522
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Namephospholipase A2 receptor 1
SynonymsM-type receptor, Pla2g1br, PLA2-I receptor
MMRRC Submission 041777-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4541 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60417543-60553308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60427738 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1199 (D1199N)
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
Predicted Effect probably damaging
Transcript: ENSMUST00000067708
AA Change: D1199N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065205
Gene: ENSMUSG00000054580
AA Change: D1199N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
RICIN 42 154 2.98e-16 SMART
FN2 174 222 1.17e-25 SMART
CLECT 232 357 7.66e-30 SMART
CLECT 380 504 1.88e-29 SMART
CLECT 517 644 5.42e-21 SMART
CLECT 664 797 3.58e-21 SMART
CLECT 812 938 7.55e-20 SMART
CLECT 957 1096 5.05e-30 SMART
CLECT 1113 1232 4.72e-21 SMART
CLECT 1246 1377 1.44e-25 SMART
transmembrane domain 1397 1419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112525
AA Change: D1199N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: D1199N

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126327
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,878,850 P73S probably benign Het
4930533L02Rik G A 7: 125,318,578 noncoding transcript Het
Acot4 A T 12: 84,043,248 I240F probably benign Het
B4galt6 A G 18: 20,745,439 V10A probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccnb3 T C X: 7,009,069 T424A probably benign Het
Cd8a A T 6: 71,373,872 D107V probably benign Het
Cdca7l T C 12: 117,872,363 S190P probably damaging Het
Ceacam12 G A 7: 18,071,723 M278I probably benign Het
Cfap43 C T 19: 47,748,015 V1346I probably benign Het
Clic5 C T 17: 44,242,069 T70M probably damaging Het
Dbpht2 A T 12: 74,299,160 noncoding transcript Het
Ddhd1 G A 14: 45,622,856 R140* probably null Het
Evpl T G 11: 116,232,644 I301L probably benign Het
Glul T A 1: 153,903,036 Y30* probably null Het
Itgad A T 7: 128,198,115 H878L probably benign Het
Kcnk10 A G 12: 98,436,277 I301T probably damaging Het
Klhl14 A T 18: 21,554,639 Y575* probably null Het
Mrps2 G T 2: 28,468,400 probably benign Het
Mymx GCC GC 17: 45,601,593 probably null Het
Napb G A 2: 148,709,309 probably benign Het
Nlrp1c-ps A G 11: 71,280,880 noncoding transcript Het
Olfr1309 A G 2: 111,983,636 I146T probably benign Het
Olfr980 A C 9: 40,006,293 S219A possibly damaging Het
Piwil4 C A 9: 14,718,316 M438I probably damaging Het
Pmpca T G 2: 26,390,189 probably benign Het
Prkcq G T 2: 11,283,812 M525I possibly damaging Het
Rnf225 T C 7: 12,928,593 probably null Het
Sco1 G T 11: 67,052,842 A50S probably benign Het
Slc12a2 T A 18: 57,912,965 probably null Het
Slc36a1 T C 11: 55,222,023 V148A probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Tbc1d10c G T 19: 4,189,474 R96S probably damaging Het
Tbc1d2b A T 9: 90,205,169 I919N probably damaging Het
Tcea1 T C 1: 4,893,436 L233P probably damaging Het
Tmem231 T C 8: 111,914,592 T223A probably benign Het
Tmem56 A G 3: 121,235,235 M1T probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tomm34 A G 2: 164,054,799 Y243H probably benign Het
Tubgcp4 A T 2: 121,195,426 N584I probably benign Het
Vldlr T C 19: 27,238,792 C7R probably damaging Het
Vmn1r42 A T 6: 89,845,551 M12K probably benign Het
Vsig10 C T 5: 117,352,816 probably benign Het
Zfp974 C G 7: 27,926,404 V14L probably damaging Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0906:Pla2r1 UTSW 2 60514947 missense possibly damaging 0.79
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2035:Pla2r1 UTSW 2 60422736 missense probably damaging 1.00
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3196:Pla2r1 UTSW 2 60522783 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R3973:Pla2r1 UTSW 2 60448962 missense probably benign 0.30
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4168:Pla2r1 UTSW 2 60497614 nonsense probably null
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6241:Pla2r1 UTSW 2 60502199 splice site probably null
R6923:Pla2r1 UTSW 2 60514966 missense probably benign 0.11
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7028:Pla2r1 UTSW 2 60458393 missense probably damaging 0.98
R7257:Pla2r1 UTSW 2 60427625 critical splice donor site probably null
R7291:Pla2r1 UTSW 2 60530435 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACCAGAGAGACTACAGGCTTC -3'
(R):5'- ATAAACTCTGTTCCCTCCACGG -3'

Sequencing Primer
(F):5'- ATTGCTGAGCACGATCATGC -3'
(R):5'- CACGGCCTCTGGGTCTTTTG -3'
Posted On2015-08-18