Incidental Mutation 'R1960:Dner'
ID317995
Institutional Source Beutler Lab
Gene Symbol Dner
Ensembl Gene ENSMUSG00000036766
Gene Namedelta/notch-like EGF repeat containing
SynonymsA930026D19Rik, BET
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1960 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location84369839-84696221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84445456 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 475 (S475R)
Ref Sequence ENSEMBL: ENSMUSP00000042927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049126]
Predicted Effect probably damaging
Transcript: ENSMUST00000049126
AA Change: S475R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042927
Gene: ENSMUSG00000036766
AA Change: S475R

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
EGF 47 92 9.85e-5 SMART
EGF 97 133 2.33e-6 SMART
EGF 306 348 1.8e1 SMART
EGF 352 390 5e-6 SMART
EGF_CA 392 428 8.97e-8 SMART
EGF 433 466 3.54e-6 SMART
EGF 471 503 4.66e-6 SMART
EGF_CA 505 541 1.61e-9 SMART
EGF 546 579 9.7e-4 SMART
EGF_CA 581 617 4.52e-13 SMART
transmembrane domain 639 661 N/A INTRINSIC
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype PHENOTYPE: Homozygous null mice display delayed cerebellar development, abnormal Bergmann glial cells, abnormal Purkinje cell innervation, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Dner
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Dner APN 1 84384010 missense probably benign 0.13
IGL02251:Dner APN 1 84384026 missense probably damaging 1.00
IGL02904:Dner APN 1 84534944 missense probably damaging 0.96
IGL03063:Dner APN 1 84585338 missense possibly damaging 0.90
R0013:Dner UTSW 1 84494893 splice site probably benign
R0112:Dner UTSW 1 84583053 missense probably benign 0.06
R0196:Dner UTSW 1 84370832 missense probably damaging 1.00
R0282:Dner UTSW 1 84405965 missense probably damaging 1.00
R0282:Dner UTSW 1 84445380 splice site probably benign
R0942:Dner UTSW 1 84585309 splice site probably benign
R1143:Dner UTSW 1 84445464 missense probably damaging 1.00
R1483:Dner UTSW 1 84585549 utr 5 prime probably benign
R1585:Dner UTSW 1 84585456 missense probably benign 0.05
R1636:Dner UTSW 1 84585330 missense possibly damaging 0.89
R1739:Dner UTSW 1 84370784 missense probably damaging 0.99
R1756:Dner UTSW 1 84445590 missense probably damaging 0.98
R2061:Dner UTSW 1 84405989 missense probably damaging 1.00
R2157:Dner UTSW 1 84383938 missense possibly damaging 0.88
R2265:Dner UTSW 1 84585549 utr 5 prime probably benign
R2382:Dner UTSW 1 84370823 missense probably damaging 1.00
R2507:Dner UTSW 1 84583080 missense probably damaging 1.00
R3053:Dner UTSW 1 84384026 missense probably damaging 1.00
R3917:Dner UTSW 1 84585549 utr 5 prime probably benign
R4530:Dner UTSW 1 84583015 missense probably damaging 1.00
R4552:Dner UTSW 1 84383857 missense probably damaging 1.00
R4579:Dner UTSW 1 84383816 missense probably damaging 0.97
R4593:Dner UTSW 1 84695728 start codon destroyed probably null
R4711:Dner UTSW 1 84383897 missense possibly damaging 0.75
R5102:Dner UTSW 1 84405970 missense probably damaging 1.00
R5314:Dner UTSW 1 84580739 missense probably damaging 1.00
R5370:Dner UTSW 1 84585549 utr 5 prime probably benign
R6000:Dner UTSW 1 84383929 missense possibly damaging 0.80
R6644:Dner UTSW 1 84395707 missense probably damaging 1.00
R6764:Dner UTSW 1 84494781 missense probably damaging 1.00
R6948:Dner UTSW 1 84406017 missense probably damaging 1.00
R6991:Dner UTSW 1 84476402 nonsense probably null
R7056:Dner UTSW 1 84580736 missense possibly damaging 0.75
R7410:Dner UTSW 1 84585611 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGAAGTGTAGGTGTATGCAC -3'
(R):5'- TCGAGAATTCAAATCCCTTCTATGC -3'

Sequencing Primer
(F):5'- TGTATGCACAGCCAAGGAAATAC -3'
(R):5'- ATGCTTTCCTGCAGGGTAC -3'
Posted On2015-05-19