Incidental Mutation 'R1960:Nlrp2'
ID318032
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene NameNLR family, pyrin domain containing 2
SynonymsNbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1960 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5298547-5351035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5327738 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 553 (E553G)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: E553G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: E553G

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Meta Mutation Damage Score 0.0312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 unclassified probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCATGAATGAGGTCAGTGCTGG -3'
(R):5'- TCGGTATCCAGCAACTCCTG -3'

Sequencing Primer
(F):5'- GGTTTTCAAATGCAAGGAGATGTCC -3'
(R):5'- CCTGGCTGCAATAATATTTGTTCAGG -3'
Posted On2015-05-19