Incidental Mutation 'R4292:Trim24'
ID 323114
Institutional Source Beutler Lab
Gene Symbol Trim24
Ensembl Gene ENSMUSG00000029833
Gene Name tripartite motif-containing 24
Synonyms D430004I05Rik, A130082H20Rik, TIF1alpha, Tif1a
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4292 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 37847746-37943231 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37877627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 39 (R39H)
Ref Sequence ENSEMBL: ENSMUSP00000114001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]
AlphaFold Q64127
Predicted Effect probably benign
Transcript: ENSMUST00000031859
SMART Domains Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 2.5e-10 SMART
BBOX 158 205 2e-13 SMART
BBOX 218 259 7e-14 SMART
BBC 266 392 3e-44 SMART
low complexity region 474 491 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
low complexity region 573 598 N/A INTRINSIC
low complexity region 686 709 N/A INTRINSIC
low complexity region 759 774 N/A INTRINSIC
PHD 829 872 2.1e-13 SMART
BROMO 902 1007 2.4e-40 SMART
low complexity region 1025 1033 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120238
AA Change: R39H

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: R39H

DomainStartEndE-ValueType
BBOX 88 135 2e-13 SMART
BBOX 148 189 6.8e-14 SMART
BBC 196 322 3e-44 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 616 639 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
PHD 759 802 2e-13 SMART
BROMO 832 937 2.4e-40 SMART
low complexity region 955 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120428
SMART Domains Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 5.22e-8 SMART
BBOX 158 205 6.27e-11 SMART
BBOX 218 259 2.22e-11 SMART
BBC 266 392 5.86e-42 SMART
low complexity region 539 564 N/A INTRINSIC
low complexity region 652 675 N/A INTRINSIC
low complexity region 725 740 N/A INTRINSIC
PHD 795 838 3.15e-11 SMART
BROMO 868 973 3.95e-38 SMART
low complexity region 991 999 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153004
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 T C 6: 92,772,977 (GRCm39) K1232E possibly damaging Het
Angel1 A G 12: 86,767,057 (GRCm39) Y440H probably damaging Het
Bclaf1 A G 10: 20,199,524 (GRCm39) Q20R probably damaging Het
Bivm A T 1: 44,177,793 (GRCm39) R364S probably damaging Het
Brwd1 G A 16: 95,818,804 (GRCm39) P1343S probably damaging Het
Cckar A G 5: 53,863,839 (GRCm39) S41P probably benign Het
Cep68 A T 11: 20,190,079 (GRCm39) V311D probably damaging Het
Cip2a T A 16: 48,833,612 (GRCm39) F571Y probably benign Het
Fhdc1 C A 3: 84,352,133 (GRCm39) V1031F probably benign Het
Gcn1 G A 5: 115,714,207 (GRCm39) A116T possibly damaging Het
Gucy1a1 A T 3: 82,002,066 (GRCm39) F671Y possibly damaging Het
Hddc2 A T 10: 31,190,583 (GRCm39) M48L possibly damaging Het
Kif18a A T 2: 109,128,471 (GRCm39) I376L probably damaging Het
Lbr C T 1: 181,648,267 (GRCm39) C398Y probably damaging Het
Myh2 A G 11: 67,085,723 (GRCm39) K1855R possibly damaging Het
Or2v2 T A 11: 49,004,254 (GRCm39) I100L probably benign Het
Or5b98 G A 19: 12,931,520 (GRCm39) C189Y possibly damaging Het
Or8d2b A G 9: 38,788,609 (GRCm39) I46V probably damaging Het
Pcdhb5 T A 18: 37,455,734 (GRCm39) S705T possibly damaging Het
Pdss2 A G 10: 43,097,834 (GRCm39) Y26C probably benign Het
Pgm2l1 A G 7: 99,899,508 (GRCm39) T41A probably damaging Het
Prss58 T C 6: 40,874,244 (GRCm39) D144G probably damaging Het
Rrp12 T C 19: 41,861,344 (GRCm39) probably null Het
Sash1 A G 10: 8,606,006 (GRCm39) S795P possibly damaging Het
Sec16a A G 2: 26,312,167 (GRCm39) Y1998H probably benign Het
Slc22a21 T C 11: 53,860,329 (GRCm39) D34G probably damaging Het
Slco4c1 C G 1: 96,772,381 (GRCm39) probably null Het
Srsf6 T C 2: 162,776,636 (GRCm39) probably benign Het
Tgfb2 T C 1: 186,364,735 (GRCm39) H253R probably damaging Het
Top3b A T 16: 16,701,383 (GRCm39) I232F probably damaging Het
Tsc22d1 T A 14: 76,656,320 (GRCm39) M851K probably benign Het
Ttn A G 2: 76,762,855 (GRCm39) V3268A possibly damaging Het
Unc79 A T 12: 103,149,703 (GRCm39) Q2599L probably damaging Het
Vmn1r192 T A 13: 22,371,465 (GRCm39) I252F probably damaging Het
Vwce A G 19: 10,636,996 (GRCm39) T693A probably benign Het
Other mutations in Trim24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Trim24 APN 6 37,880,583 (GRCm39) missense possibly damaging 0.76
IGL01307:Trim24 APN 6 37,942,570 (GRCm39) missense possibly damaging 0.81
IGL01790:Trim24 APN 6 37,922,548 (GRCm39) missense probably benign
IGL02525:Trim24 APN 6 37,922,653 (GRCm39) missense probably damaging 0.99
IGL02557:Trim24 APN 6 37,942,434 (GRCm39) critical splice acceptor site probably null
IGL02671:Trim24 APN 6 37,937,719 (GRCm39) missense probably damaging 1.00
IGL02795:Trim24 APN 6 37,896,324 (GRCm39) missense probably damaging 1.00
IGL02877:Trim24 APN 6 37,942,581 (GRCm39) missense probably damaging 1.00
IGL02889:Trim24 APN 6 37,934,696 (GRCm39) missense probably benign 0.02
IGL02930:Trim24 APN 6 37,928,380 (GRCm39) splice site probably benign
IGL03076:Trim24 APN 6 37,942,567 (GRCm39) missense probably damaging 0.98
accomodating UTSW 6 37,896,332 (GRCm39) missense probably damaging 1.00
apprehensive UTSW 6 37,934,435 (GRCm39) splice site probably benign
Flexible UTSW 6 37,880,588 (GRCm39) critical splice donor site probably benign
Lithe UTSW 6 37,935,504 (GRCm39) missense probably damaging 1.00
Nervous UTSW 6 37,934,664 (GRCm39) missense probably damaging 1.00
perturbed UTSW 6 37,896,427 (GRCm39) critical splice donor site probably null
pliant UTSW 6 37,896,426 (GRCm39) critical splice donor site probably null
qualmish UTSW 6 37,880,587 (GRCm39) critical splice donor site probably null
Queasy UTSW 6 37,885,240 (GRCm39) missense probably damaging 0.99
squeamish UTSW 6 37,892,137 (GRCm39) nonsense probably null
uneasy UTSW 6 37,933,412 (GRCm39) critical splice donor site probably null
PIT4651001:Trim24 UTSW 6 37,877,667 (GRCm39) critical splice donor site probably null
R0037:Trim24 UTSW 6 37,934,484 (GRCm39) missense probably damaging 1.00
R0037:Trim24 UTSW 6 37,934,484 (GRCm39) missense probably damaging 1.00
R0183:Trim24 UTSW 6 37,920,415 (GRCm39) missense possibly damaging 0.90
R0471:Trim24 UTSW 6 37,892,130 (GRCm39) missense possibly damaging 0.94
R0485:Trim24 UTSW 6 37,934,001 (GRCm39) missense probably damaging 1.00
R0606:Trim24 UTSW 6 37,848,169 (GRCm39) missense probably benign
R0609:Trim24 UTSW 6 37,934,718 (GRCm39) missense probably damaging 1.00
R0637:Trim24 UTSW 6 37,935,494 (GRCm39) splice site probably null
R0734:Trim24 UTSW 6 37,896,400 (GRCm39) missense possibly damaging 0.86
R0855:Trim24 UTSW 6 37,892,137 (GRCm39) nonsense probably null
R1131:Trim24 UTSW 6 37,934,717 (GRCm39) missense probably damaging 1.00
R1141:Trim24 UTSW 6 37,892,228 (GRCm39) missense probably damaging 1.00
R1159:Trim24 UTSW 6 37,933,412 (GRCm39) critical splice donor site probably null
R1460:Trim24 UTSW 6 37,941,761 (GRCm39) missense probably damaging 1.00
R1672:Trim24 UTSW 6 37,892,214 (GRCm39) missense probably damaging 1.00
R1868:Trim24 UTSW 6 37,928,447 (GRCm39) missense probably damaging 0.99
R1888:Trim24 UTSW 6 37,934,013 (GRCm39) missense probably damaging 0.99
R1888:Trim24 UTSW 6 37,934,013 (GRCm39) missense probably damaging 0.99
R1894:Trim24 UTSW 6 37,934,013 (GRCm39) missense probably damaging 0.99
R1913:Trim24 UTSW 6 37,934,750 (GRCm39) missense probably damaging 1.00
R2254:Trim24 UTSW 6 37,935,612 (GRCm39) missense probably benign
R2511:Trim24 UTSW 6 37,880,587 (GRCm39) critical splice donor site probably null
R2849:Trim24 UTSW 6 37,933,388 (GRCm39) missense probably damaging 0.99
R3878:Trim24 UTSW 6 37,941,708 (GRCm39) missense probably benign 0.14
R4084:Trim24 UTSW 6 37,892,192 (GRCm39) missense probably damaging 1.00
R4235:Trim24 UTSW 6 37,941,675 (GRCm39) missense probably damaging 1.00
R4633:Trim24 UTSW 6 37,933,371 (GRCm39) missense probably damaging 0.98
R4651:Trim24 UTSW 6 37,934,774 (GRCm39) critical splice donor site probably null
R4652:Trim24 UTSW 6 37,934,774 (GRCm39) critical splice donor site probably null
R4686:Trim24 UTSW 6 37,885,240 (GRCm39) missense probably damaging 0.99
R5000:Trim24 UTSW 6 37,935,547 (GRCm39) missense probably benign 0.01
R5213:Trim24 UTSW 6 37,934,010 (GRCm39) missense probably damaging 0.99
R5258:Trim24 UTSW 6 37,896,335 (GRCm39) missense probably benign 0.37
R5292:Trim24 UTSW 6 37,880,539 (GRCm39) missense probably benign 0.23
R5395:Trim24 UTSW 6 37,934,679 (GRCm39) missense probably damaging 1.00
R5547:Trim24 UTSW 6 37,942,485 (GRCm39) missense probably damaging 1.00
R5666:Trim24 UTSW 6 37,942,536 (GRCm39) missense probably benign 0.19
R5670:Trim24 UTSW 6 37,942,536 (GRCm39) missense probably benign 0.19
R5849:Trim24 UTSW 6 37,934,664 (GRCm39) missense probably damaging 1.00
R5927:Trim24 UTSW 6 37,935,504 (GRCm39) missense probably damaging 1.00
R5932:Trim24 UTSW 6 37,934,010 (GRCm39) missense probably damaging 0.99
R6286:Trim24 UTSW 6 37,896,426 (GRCm39) critical splice donor site probably null
R6374:Trim24 UTSW 6 37,930,484 (GRCm39) missense probably benign 0.12
R6449:Trim24 UTSW 6 37,880,587 (GRCm39) critical splice donor site probably null
R6723:Trim24 UTSW 6 37,928,403 (GRCm39) missense probably benign 0.00
R6731:Trim24 UTSW 6 37,920,420 (GRCm39) missense probably damaging 0.99
R6975:Trim24 UTSW 6 37,896,427 (GRCm39) critical splice donor site probably null
R7000:Trim24 UTSW 6 37,935,613 (GRCm39) missense probably benign 0.24
R7067:Trim24 UTSW 6 37,934,775 (GRCm39) splice site probably null
R7126:Trim24 UTSW 6 37,896,392 (GRCm39) missense probably damaging 1.00
R7162:Trim24 UTSW 6 37,942,456 (GRCm39) missense possibly damaging 0.68
R7486:Trim24 UTSW 6 37,934,774 (GRCm39) critical splice donor site probably null
R7779:Trim24 UTSW 6 37,896,333 (GRCm39) missense probably damaging 0.99
R7779:Trim24 UTSW 6 37,896,332 (GRCm39) missense probably damaging 1.00
R8070:Trim24 UTSW 6 37,934,661 (GRCm39) missense probably damaging 0.99
R8096:Trim24 UTSW 6 37,935,592 (GRCm39) missense probably benign 0.03
R8184:Trim24 UTSW 6 37,848,242 (GRCm39) missense probably damaging 1.00
R8323:Trim24 UTSW 6 37,892,233 (GRCm39) critical splice donor site probably null
R8476:Trim24 UTSW 6 37,922,578 (GRCm39) nonsense probably null
R8705:Trim24 UTSW 6 37,880,588 (GRCm39) critical splice donor site probably benign
R8770:Trim24 UTSW 6 37,934,435 (GRCm39) splice site probably benign
R9021:Trim24 UTSW 6 37,933,949 (GRCm39) missense probably damaging 0.99
R9166:Trim24 UTSW 6 37,934,074 (GRCm39) missense probably damaging 1.00
R9212:Trim24 UTSW 6 37,896,335 (GRCm39) missense probably benign 0.37
R9350:Trim24 UTSW 6 37,892,208 (GRCm39) missense probably damaging 1.00
R9678:Trim24 UTSW 6 37,942,449 (GRCm39) missense probably damaging 1.00
RF007:Trim24 UTSW 6 37,930,471 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTGGAGACCCAGCCTTTAAC -3'
(R):5'- TACCTGGCCCCTAAAATTATGAG -3'

Sequencing Primer
(F):5'- AGCCTTTAACAGGGGCAC -3'
(R):5'- TTATCCCAGTAGGCAGATGATCC -3'
Posted On 2015-06-20