Incidental Mutation 'R2254:Trim24'
ID241863
Institutional Source Beutler Lab
Gene Symbol Trim24
Ensembl Gene ENSMUSG00000029833
Gene Nametripartite motif-containing 24
SynonymsA130082H20Rik, D430004I05Rik, TIF1alpha, Tif1a
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location37870811-37966296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37958677 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 868 (T868A)
Ref Sequence ENSEMBL: ENSMUSP00000113063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]
Predicted Effect probably benign
Transcript: ENSMUST00000031859
AA Change: T902A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: T902A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 2.5e-10 SMART
BBOX 158 205 2e-13 SMART
BBOX 218 259 7e-14 SMART
BBC 266 392 3e-44 SMART
low complexity region 474 491 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
low complexity region 573 598 N/A INTRINSIC
low complexity region 686 709 N/A INTRINSIC
low complexity region 759 774 N/A INTRINSIC
PHD 829 872 2.1e-13 SMART
BROMO 902 1007 2.4e-40 SMART
low complexity region 1025 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120238
AA Change: T832A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: T832A

DomainStartEndE-ValueType
BBOX 88 135 2e-13 SMART
BBOX 148 189 6.8e-14 SMART
BBC 196 322 3e-44 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 616 639 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
PHD 759 802 2e-13 SMART
BROMO 832 937 2.4e-40 SMART
low complexity region 955 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120428
AA Change: T868A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: T868A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 5.22e-8 SMART
BBOX 158 205 6.27e-11 SMART
BBOX 218 259 2.22e-11 SMART
BBC 266 392 5.86e-42 SMART
low complexity region 539 564 N/A INTRINSIC
low complexity region 652 675 N/A INTRINSIC
low complexity region 725 740 N/A INTRINSIC
PHD 795 838 3.15e-11 SMART
BROMO 868 973 3.95e-38 SMART
low complexity region 991 999 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Trim24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Trim24 APN 6 37903648 missense possibly damaging 0.76
IGL01307:Trim24 APN 6 37965635 missense possibly damaging 0.81
IGL01790:Trim24 APN 6 37945613 missense probably benign
IGL02525:Trim24 APN 6 37945718 missense probably damaging 0.99
IGL02557:Trim24 APN 6 37965499 critical splice acceptor site probably null
IGL02671:Trim24 APN 6 37960784 missense probably damaging 1.00
IGL02795:Trim24 APN 6 37919389 missense probably damaging 1.00
IGL02877:Trim24 APN 6 37965646 missense probably damaging 1.00
IGL02889:Trim24 APN 6 37957761 missense probably benign 0.02
IGL02930:Trim24 APN 6 37951445 splice site probably benign
IGL03076:Trim24 APN 6 37965632 missense probably damaging 0.98
Lithe UTSW 6 37958569 missense probably damaging 1.00
Nervous UTSW 6 37957729 missense probably damaging 1.00
pliant UTSW 6 37919491 critical splice donor site probably null
qualmish UTSW 6 37903652 critical splice donor site probably null
Queasy UTSW 6 37908305 missense probably damaging 0.99
squeamish UTSW 6 37915202 nonsense probably null
Uneasy UTSW 6 37956477 critical splice donor site probably null
PIT4651001:Trim24 UTSW 6 37900732 critical splice donor site probably null
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0183:Trim24 UTSW 6 37943480 missense possibly damaging 0.90
R0471:Trim24 UTSW 6 37915195 missense possibly damaging 0.94
R0485:Trim24 UTSW 6 37957066 missense probably damaging 1.00
R0606:Trim24 UTSW 6 37871234 missense probably benign
R0609:Trim24 UTSW 6 37957783 missense probably damaging 1.00
R0637:Trim24 UTSW 6 37958559 splice site probably null
R0734:Trim24 UTSW 6 37919465 missense possibly damaging 0.86
R0855:Trim24 UTSW 6 37915202 nonsense probably null
R1131:Trim24 UTSW 6 37957782 missense probably damaging 1.00
R1141:Trim24 UTSW 6 37915293 missense probably damaging 1.00
R1159:Trim24 UTSW 6 37956477 critical splice donor site probably null
R1460:Trim24 UTSW 6 37964826 missense probably damaging 1.00
R1672:Trim24 UTSW 6 37915279 missense probably damaging 1.00
R1868:Trim24 UTSW 6 37951512 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1894:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1913:Trim24 UTSW 6 37957815 missense probably damaging 1.00
R2511:Trim24 UTSW 6 37903652 critical splice donor site probably null
R2849:Trim24 UTSW 6 37956453 missense probably damaging 0.99
R3878:Trim24 UTSW 6 37964773 missense probably benign 0.14
R4084:Trim24 UTSW 6 37915257 missense probably damaging 1.00
R4235:Trim24 UTSW 6 37964740 missense probably damaging 1.00
R4292:Trim24 UTSW 6 37900692 missense possibly damaging 0.91
R4633:Trim24 UTSW 6 37956436 missense probably damaging 0.98
R4651:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4652:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4686:Trim24 UTSW 6 37908305 missense probably damaging 0.99
R5000:Trim24 UTSW 6 37958612 missense probably benign 0.01
R5213:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R5258:Trim24 UTSW 6 37919400 missense probably damaging 0.99
R5292:Trim24 UTSW 6 37903604 missense probably benign 0.23
R5395:Trim24 UTSW 6 37957744 missense probably damaging 1.00
R5547:Trim24 UTSW 6 37965550 missense probably damaging 1.00
R5666:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5670:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5849:Trim24 UTSW 6 37957729 missense probably damaging 1.00
R5927:Trim24 UTSW 6 37958569 missense probably damaging 1.00
R5932:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R6286:Trim24 UTSW 6 37919491 critical splice donor site probably null
R6374:Trim24 UTSW 6 37953549 missense probably benign 0.12
R6449:Trim24 UTSW 6 37903652 critical splice donor site probably null
R6723:Trim24 UTSW 6 37951468 missense probably benign 0.00
R6731:Trim24 UTSW 6 37943485 missense probably damaging 0.99
R6975:Trim24 UTSW 6 37919492 critical splice donor site probably null
R7000:Trim24 UTSW 6 37958678 missense probably benign 0.24
R7126:Trim24 UTSW 6 37919457 missense probably damaging 1.00
R7162:Trim24 UTSW 6 37965521 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGTGGTGAAGACAGAGCTC -3'
(R):5'- GCATGGATGAGCGTTCATG -3'

Sequencing Primer
(F):5'- TGAAGACAGAGCTCCGACATACTTAG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2014-10-16