Incidental Mutation 'R0004:Arhgap32'
ID32395
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0004 (G1)
Quality Score212
Status Validated (trace)
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32151998 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 101 (V101A)
Ref Sequence ENSEMBL: ENSMUSP00000133898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641]
Predicted Effect probably damaging
Transcript: ENSMUST00000174641
AA Change: V101A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: V101A

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182310
AA Change: V62A
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGGTCTCACTAGATGGTAGTGACA -3'
(R):5'- GCCAGCTCTATACGTTCTCGTTAGACAA -3'

Sequencing Primer
(F):5'- agccatctctccagccc -3'
(R):5'- GTTCTCGTTAGACAACTGCAAC -3'
Posted On2013-05-09