Incidental Mutation 'R4670:Arhgap32'
ID348370
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 041926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4670 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32170145 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 153 (E153G)
Ref Sequence ENSEMBL: ENSMUSP00000133898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641]
Predicted Effect probably benign
Transcript: ENSMUST00000174641
AA Change: E153G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: E153G

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182310
AA Change: E128G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213983
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,531,760 probably null Het
Alb T A 5: 90,462,806 S82T probably benign Het
Arf4 A G 14: 26,653,093 probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Arhgef18 T A 8: 3,434,897 M200K probably damaging Het
Atp1a4 T A 1: 172,235,000 N647Y probably benign Het
Atp5c1 A T 2: 10,059,617 L226Q probably damaging Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cadm3 T A 1: 173,346,446 T67S probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Chst7 C A X: 20,060,871 R386S probably damaging Het
Cyp4f37 A T 17: 32,625,152 M77L probably benign Het
Dnah7b A T 1: 46,078,524 D50V probably damaging Het
Galnt4 A G 10: 99,109,298 D295G possibly damaging Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm6471 G A 7: 142,831,623 noncoding transcript Het
Gm6818 T A 7: 38,402,557 noncoding transcript Het
Gm9271 T A 7: 39,364,310 noncoding transcript Het
Gpam A G 19: 55,096,119 probably null Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Ift140 C A 17: 25,098,961 probably benign Het
Itih5 A C 2: 10,190,369 I191L probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kank1 T C 19: 25,410,580 M511T probably benign Het
Krt74 A T 15: 101,758,869 noncoding transcript Het
Lrrc37a A G 11: 103,504,537 S21P probably benign Het
Lrrc8c G A 5: 105,608,374 V672I probably benign Het
Lypd4 T C 7: 24,866,726 R58G probably benign Het
Magi1 A T 6: 93,686,643 probably null Het
Mefv T A 16: 3,708,207 L745F possibly damaging Het
Myh13 A T 11: 67,364,738 K1645* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nlrp1c-ps T C 11: 71,280,556 noncoding transcript Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1084 T C 2: 86,639,168 D180G possibly damaging Het
Olfr231 T A 1: 174,117,861 M52L probably benign Het
Olfr612 A G 7: 103,539,186 V16A possibly damaging Het
P2ry12 T C 3: 59,217,904 probably null Het
Pcx T A 19: 4,619,888 V861E probably damaging Het
Pkp3 C T 7: 141,082,699 P75S probably benign Het
Plscr4 T C 9: 92,482,867 probably null Het
Pole A G 5: 110,306,387 T923A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rhot2 A C 17: 25,841,331 probably benign Het
Rsrp1 A G 4: 134,924,177 Y84C unknown Het
Sbf2 T C 7: 110,335,399 K1348E probably damaging Het
Sgip1 A T 4: 102,869,754 N53Y probably damaging Het
Snapc2 A G 8: 4,254,998 T127A possibly damaging Het
Snx8 A G 5: 140,355,958 probably null Het
Spag8 A G 4: 43,653,378 probably benign Het
Srebf2 T C 15: 82,192,302 F718L probably damaging Het
Szt2 C G 4: 118,375,829 probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Tubgcp4 T A 2: 121,173,665 Y62* probably null Het
Usp29 T A 7: 6,962,915 S586T possibly damaging Het
Vasp T C 7: 19,264,425 N108S probably benign Het
Vmn1r214 A G 13: 23,034,971 M212V probably benign Het
Wipi2 G C 5: 142,659,590 A194P probably benign Het
Zbtb4 T A 11: 69,776,529 I220N probably damaging Het
Zcchc2 A T 1: 105,990,266 probably benign Het
Zfp729a T A 13: 67,621,415 K232* probably null Het
Zfp995 A T 17: 21,887,339 M1K probably null Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
R7391:Arhgap32 UTSW 9 32181939 missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32245924 missense probably benign 0.06
R7653:Arhgap32 UTSW 9 32257145 missense probably benign
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTAAGCTGTAGACTTATAAGGC -3'
(R):5'- GTGTGCTCACTGAACAATGGC -3'

Sequencing Primer
(F):5'- ATAAGGCACATTAGCTTGGTGTC -3'
(R):5'- GCTCACTGAACAATGGCATAATTAC -3'
Posted On2015-10-08