Mutagenetix > Incidental Mutation

Incidental Mutation 'R4383:Zap70'

325396

Institutional Source

Beutler Lab

Gene Symbol

Zap70

Ensembl Gene

ENSMUSG00000026117

Gene Name

zeta-chain (TCR) associated protein kinase

Synonyms

ZAP-70, TZK, Srk

MMRRC Submission

041123-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R4383 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36800879-36821899 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 36820042 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 471 (R471W)

Ref Sequence

ENSEMBL: ENSMUSP00000027291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027291]

AlphaFold

P43404

Predicted Effect

probably damaging
Transcript: ENSMUST00000027291
AA Change: R471W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: R471W

Domain	Start	End	E-Value	Type
SH2	8	93	6.73e-25	SMART
SH2	161	245	1.59e-26	SMART
low complexity region	257	265	N/A	INTRINSIC
TyrKc	337	592	1e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190128

Meta Mutation Damage Score

0.4320

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

89% (32/36)

MGI Phenotype

FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	C	1: 63,605,787 (GRCm39)	Y624H	probably damaging	Het
Arih2	T	G	9: 108,521,476 (GRCm39)	M1L	probably benign	Het
Asic3	A	G	5: 24,618,932 (GRCm39)	T75A	probably damaging	Het
Baat	C	T	4: 49,499,731 (GRCm39)	A192T	probably damaging	Het
Calr3	T	A	8: 73,182,008 (GRCm39)	D120V	probably damaging	Het
Clca3a2	T	C	3: 144,512,081 (GRCm39)	I552V	probably benign	Het
Cnot10	T	A	9: 114,460,949 (GRCm39)	K74*	probably null	Het
Des	T	C	1: 75,337,413 (GRCm39)	F118L	possibly damaging	Het
Ermard	T	C	17: 15,280,128 (GRCm39)	S130P	possibly damaging	Het
Fbxl5	A	G	5: 43,920,305 (GRCm39)		probably benign	Het
Gad2	G	A	2: 22,575,422 (GRCm39)	V509I	probably benign	Het
Inmt	C	A	6: 55,148,203 (GRCm39)	C142F	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 53,032,934 (GRCm39)	74	probably benign	Het
Kmt2c	A	T	5: 25,556,060 (GRCm39)	D1228E	possibly damaging	Het
Marf1	T	A	16: 13,960,505 (GRCm39)	Y513F	possibly damaging	Het
Msh2	G	A	17: 87,996,566 (GRCm39)	E425K	probably benign	Het
Or6n2	T	C	1: 173,897,043 (GRCm39)	Y60H	probably benign	Het
Poc1b	A	G	10: 98,992,161 (GRCm39)	D326G	probably damaging	Het
Rbp3	G	C	14: 33,677,253 (GRCm39)	E400D	probably benign	Het
Rsf1	A	G	7: 97,334,683 (GRCm39)	K1272R	possibly damaging	Het
Sec24c	G	A	14: 20,740,841 (GRCm39)	V620M	probably damaging	Het
Trim3	C	T	7: 105,267,606 (GRCm39)	A264T	probably damaging	Het
Ubr2	G	C	17: 47,250,313 (GRCm39)	H1545D	probably benign	Het
Vps13a	A	T	19: 16,678,529 (GRCm39)	C1151S	probably damaging	Het
Zfp329	G	A	7: 12,545,584 (GRCm39)		probably benign	Het
Zfp606	A	T	7: 12,227,928 (GRCm39)	Y625F	probably damaging	Het

Other mutations in Zap70

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
mrtless	APN	1	36,820,230 (GRCm39)	missense	probably damaging	1.00
murdock	APN	1	36,818,785 (GRCm39)	missense	probably damaging	0.99
IGL00763:Zap70	APN	1	36,818,333 (GRCm39)	missense	possibly damaging	0.81
IGL01635:Zap70	APN	1	36,810,238 (GRCm39)	missense	probably damaging	0.99
IGL01918:Zap70	APN	1	36,817,868 (GRCm39)	missense	possibly damaging	0.64
IGL02164:Zap70	APN	1	36,810,267 (GRCm39)	missense	probably damaging	0.99
IGL02502:Zap70	APN	1	36,817,887 (GRCm39)	splice site	probably benign
IGL02597:Zap70	APN	1	36,811,001 (GRCm39)	nonsense	probably null
IGL03026:Zap70	APN	1	36,818,798 (GRCm39)	missense	possibly damaging	0.94
biscayne	UTSW	1	36,820,493 (GRCm39)	missense	probably damaging	1.00
mesa_verde	UTSW	1	36,818,254 (GRCm39)	missense	probably damaging	1.00
shazzam	UTSW	1	36,820,218 (GRCm39)	missense	probably damaging	1.00
trebia	UTSW	1	36,820,106 (GRCm39)	missense	probably damaging	1.00
wanna	UTSW	1	36,810,064 (GRCm39)	missense	probably damaging	1.00
wanna2	UTSW	1	36,820,493 (GRCm39)	missense	probably damaging	1.00
wanna3	UTSW	1	36,817,299 (GRCm39)	missense	probably damaging	0.99
wanna4	UTSW	1	36,820,446 (GRCm39)	missense	probably damaging	1.00
want_to	UTSW	1	36,821,598 (GRCm39)	missense	probably damaging	1.00
waterfowl	UTSW	1	36,809,892 (GRCm39)	start codon destroyed	probably null	0.03
zapatos	UTSW	1	36,810,262 (GRCm39)	missense	possibly damaging	0.89
zipper	UTSW	1	36,809,983 (GRCm39)	missense	probably benign	0.09
PIT1430001:Zap70	UTSW	1	36,818,250 (GRCm39)	missense	possibly damaging	0.95
R0487:Zap70	UTSW	1	36,818,365 (GRCm39)	missense	probably damaging	1.00
R0701:Zap70	UTSW	1	36,820,258 (GRCm39)	missense	probably damaging	1.00
R0960:Zap70	UTSW	1	36,818,254 (GRCm39)	missense	probably damaging	1.00
R1520:Zap70	UTSW	1	36,810,036 (GRCm39)	missense	probably damaging	1.00
R2064:Zap70	UTSW	1	36,818,215 (GRCm39)	missense	probably benign
R3623:Zap70	UTSW	1	36,818,216 (GRCm39)	missense	probably benign	0.03
R3689:Zap70	UTSW	1	36,820,493 (GRCm39)	missense	probably damaging	1.00
R3690:Zap70	UTSW	1	36,820,493 (GRCm39)	missense	probably damaging	1.00
R3804:Zap70	UTSW	1	36,810,223 (GRCm39)	missense	possibly damaging	0.58
R3840:Zap70	UTSW	1	36,817,498 (GRCm39)	missense	probably damaging	1.00
R4260:Zap70	UTSW	1	36,818,189 (GRCm39)	splice site	probably benign
R4632:Zap70	UTSW	1	36,817,539 (GRCm39)	missense	probably benign
R4783:Zap70	UTSW	1	36,818,254 (GRCm39)	missense	probably damaging	1.00
R5051:Zap70	UTSW	1	36,820,532 (GRCm39)	missense	probably benign	0.00
R5271:Zap70	UTSW	1	36,820,446 (GRCm39)	missense	probably damaging	1.00
R5304:Zap70	UTSW	1	36,817,299 (GRCm39)	missense	probably damaging	0.99
R5792:Zap70	UTSW	1	36,818,090 (GRCm39)	intron	probably benign
R5932:Zap70	UTSW	1	36,820,227 (GRCm39)	missense	probably damaging	1.00
R5941:Zap70	UTSW	1	36,810,030 (GRCm39)	missense	probably damaging	1.00
R6694:Zap70	UTSW	1	36,821,598 (GRCm39)	missense	probably damaging	1.00
R6825:Zap70	UTSW	1	36,817,471 (GRCm39)	missense	probably damaging	1.00
R7039:Zap70	UTSW	1	36,817,832 (GRCm39)	missense	probably benign
R7704:Zap70	UTSW	1	36,818,395 (GRCm39)	critical splice donor site	probably null
R7769:Zap70	UTSW	1	36,809,983 (GRCm39)	missense	probably benign	0.09
R8115:Zap70	UTSW	1	36,820,287 (GRCm39)	missense	probably damaging	1.00
R8140:Zap70	UTSW	1	36,810,262 (GRCm39)	missense	possibly damaging	0.89
R8289:Zap70	UTSW	1	36,820,218 (GRCm39)	missense	probably damaging	1.00
R9186:Zap70	UTSW	1	36,818,832 (GRCm39)	missense	possibly damaging	0.66
R9540:Zap70	UTSW	1	36,817,869 (GRCm39)	missense	possibly damaging	0.95
R9654:Zap70	UTSW	1	36,818,327 (GRCm39)	missense	probably benign	0.03
R9674:Zap70	UTSW	1	36,810,150 (GRCm39)	missense	probably benign	0.10
S24628:Zap70	UTSW	1	36,809,892 (GRCm39)	start codon destroyed	probably null	0.03
Z1176:Zap70	UTSW	1	36,818,257 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGTTTTCTACACCCATGCC -3'
(R):5'- GAAAGTTGATGCACTCTGGC -3'

Sequencing Primer
(F):5'- TCTACACCCATGCCCCATG -3'
(R):5'- GTACCACTTCAGAGGCCACTTC -3'

Posted On

2015-07-06