Phenotypic Mutation 'wanna4' (pdf version)
Allelewanna4
Mutation Type missense
Chromosome1
Coordinate36,781,365 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,761,798-36,782,818 bp (+)
MGI Phenotype Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis.
Accession Number

NCBI RefSeq: NM_009539 (variant 1), NM_001289612 (variant 2), NM_001289765 (variant 3), NM_001289766 (variant 4); MGI: 99613

Mapped Yes 
Limits of the Critical Region 36761798 - 36782818 bp
Amino Acid Change Valine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027291]
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: V547D

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000027291)
Phenotypic Category Autosomal Recessive
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(27) : Chemically induced (ENU)(7) Chemically induced (other)(1) Gene trapped(1) Spontaneous (2) Targeted(11) Transgenic(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense possibly damaging 0.95
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 unclassified noncoding transcript
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site noncoding transcript
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron noncoding transcript
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-08-09 10:25 AM by Anne Murray
Record Created 2017-07-01 9:09 AM by Jin Huk Choi
Record Posted 2017-08-09
Phenotypic Description

Figure 1. Wanna4 mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Wanna4 mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Wanna4 mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Wanna4 mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Wanna4 mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Wanna4 mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Wanna4 mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Wanna4 mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Wanna4 mice exhibit increased frequencies of peripheral central memory CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Wanna4 mice exhibit increased frequencies of peripheral central memory CD8+ T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Wanna4 mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Wanna4 mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Wanna4 mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Wanna4 mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Wanna4 mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The wanna4 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5271, some of which showed an increased B to T cell ratio (Figure 1) due to reduced frequencies of T cells (Figure 2), CD4+ T cells (Figure 3), CD4+ T cells in CD3+ T cells (Figure 4), naïve CD4 T cells in CD4 T cells (Figure 5), CD8+ T cells (Figure 6), CD8+ T cells in CD3+ T cells (Figure 7), and naïve CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of central memory CD4 T cells in CD4 T cells (Figure 9), and central memory CD8 T cells in CD8 T cells (Figure 10), all in the peripheral blood. Some mice showed an increase in the CD4 to CD8 T cell ratio (Figure 11) as well as increased expression of CD44 on T cells (Figure 12), CD4 T cells (Figure 13) and CD8 T cells (Figure 14). The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 15).

Nature of Mutation

Figure 16. Linkage mapping of the B to T cell ratio phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R5271. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 1: Zap70 and Tbc1d8. The mutation in Zap70 was presumed causative because the wanna4 phenotypes mimic that of other Zap70 alleles (see MGI). The Zap70 mutation is a T to A transversion at base pair 36,781,365 (v38) on chromosome 1, or base pair 19,568 in the GenBank genomic region NC_000067 encoding Zap70.  The strongest association was found with a recessive model of inheritance to the normalized B to T cell ratio phenotype, wherein two variant homozygotes departed phenotypically from 15 homozygous reference mice and 22 heterozygous mice with a P value of 5.392 x 10-54 (Figure 16).  A substantial semidominant effect was observed in some of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 1,802 in the mRNA sequence NM_001289766 within exon 12 of 13 total exons.

 

1786 ATGAAGGGCCCCGAGGTCCTGGACTTCATCAAG
542  -M--K--G--P--E--V--L--D--F--I--K-
 

The mutated nucleotide is indicated in red.  The mutation results in a valine to aspartic acid substitution at position 547 (V547D) in the ZAP70 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 17. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The wanna4 mutation causes a valine to aspartic acid substitution at position 547 (V547D). The 3D structure is human ZAP70. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Click on the image to view other mutations found in ZAP-70 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The ζ-associated protein of 70 kDa (ZAP-70) is a protein tyrosine kinase (PTK) that binds to the doubly phosphorylated immunoreceptor tyrosine-based activation motifs (ITAMS) of ζ and CD3ε chains of the T cell receptor (TCR; see the record for tumormouse). ZAP70 consists of two N-terminal Src-homology 2 (SH2) domains at amino acids and a C-terminal kinase domain (Figure 17). The SH2 domains are connected by a linker known as interdomain A, while the region between the second SH2 and catalytic domains is known as interdomain B (2). The two SH2 domains of mouse ZAP-70 occur at amino acids 10-102 and 163-254, and work cooperatively to bind to the phosphorylated tyrosines of an ITAM sequence [(D/E)xxYxxI/Lx(6-8)YxxI/L]. The wanna4 mutation results in a valine to aspartic acid substitution at position 547 (V547D); residue 547 is within the kinase domain.

 

Please see the record for murdock for more information about Zap70.

Putative Mechanism

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (3;4)]. Syk and ZAP-70 function as critical mediators of pre-TCR and TCR signaling, with ZAP-70 having a predominant role in mature T cells (4;5). Once activated, ZAP-70 and Syk interact with and phosphorylate a number of substrates important for TCR signaling including the adaptor proteins the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6;7). Once phosphorylated, these two adaptors serve as docking sites and organize a number of effector molecules into the correct spatiotemporal manner to allow the activation of multiple signaling pathways. Zap70 knockout mice display an arrest of T cell development at the DP stage, the second critical checkpoint important during αβ T cell development due to defective TCR-mediated selection and signaling at this stage (5;8). Although ZAP-70 has a critical role in T cell development and function, it also plays a role downstream of the BCR and in NK cells. Zap70 knockout mice display normal B cell development, mount normal antibody responses and also proliferate appropriately to various stimuli (9).  The phenotype of the wanna4 mice is similar to loss-of-function alleles of Zap70.

Primers PCR Primer
wanna4(F):5'- CAGAGTGCATCAACTTTCGGAAG -3'
wanna4(R):5'- CTAAGGGTAAAGGTAGCGCTGC -3'

Sequencing Primer
wanna4_seq(F):5'- AAGTTCTCCAGCCGCAGTGAC -3'
wanna4_seq(R):5'- TAAAGGTAGCGCTGCCTGGG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, Bruce Beutler